Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit

Nathalie Arricau-Bouvery and Armel Souriau
INRA centre of TOURS, Unit de Pathologie Infectieuse et Immunologie, 37380 NOUZILLY FRANCE
Phone: (33) 0247427634, Fax: (33) 0247427779, e-mail: bouvery@tours.inra.fr Introduction

Coxiella burnetii, the etiologic agent of Q fever, is an obligate intracellular bacterium. The reservoirs are extensive but partially known, and include mammals, birds and arthropods. Farm animals (i.e., cattle, sheep, goats) are identified as principal sources of human infection 1. Routine diagnosis of Q fever in veterinary medicine is usually performed by Stamp staining of the placenta or serological tests. Isolation and quantitation of C. burnetii are difficult, time consuming and require confined level L3 laboratories. Detection of C. burnetii is possible by using cell culture (shell vial culture system), but essentially it is used in clinical practice 5. Polymerase chain reaction has become a useful tool for the detection of C. burnetii in biological samples 6. However, this necessitates the extraction of the genomic DNA of C. burnetii without purification of bacteria. Thus, the samples contain gDNA of the bacteria and the eukaryotic cells. Different methods are reported in the literature 2, 4, but the sensitivity is very low or the method is not adapted to samples containing blood.

In this article, we report that the Perfect gDNA Blood Mini Kit from Eppendorf is highly adapted to the C. burnetii gDNA extraction when the bacterium is present in goat placenta (blood), mouse spleen or milk.

Materials and Methods

Samples:

  1. Placenta (goat): the placenta was homogenized in sterile physiological buffer and is constituted essentially of blood.
  2. Spleen (mouse): the spleen was homogenized in sterile physiological buffer.
  3. Milk (bovine)
  4. Blood: the results found with blood provided by animals naturally infected with C. burnetii are the same as those found with placenta, but are not as strong. Indeed, animal blood is deficient in bacterial particles and its difficult to project if and when the bacteria is present in the blood. Thus, only results found with placenta are shown here and represent the results we could have found with blood.
DNA Extraction:

Total DNA was directly extracted from 20 l and 50 l of homogenized goat placenta naturally contaminated by C. burnetii (genome size: 2,103 kb), 10 l, 30 l and 50 l of homogenized mouse spleen (mouse injected intraperitoneally with C. burnetii) and 100 l of bovine milk contaminated by infective suspension of C. burnetii and containing 108 or 107 bacteria/ml). The extraction was carried out using the Eppendorf Perfect gDNA Blood Mini Kit as recommended in the manual with the exception of two steps: the lysis with Proteinase K was performed at 70C in a water bath over a thirty minute period (and could now be frozen at 20C before continuing the DNA extraction), and the final step: gDNA was eluted with 150 l of Elution Buffer.

PCR:

Two primers, Trans1 and Trans2, derived from a transposon-like repetitive region of the C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water) Fig. 2: Amplification of a 687 bp fragment of genomic DNA from Coxiella burnetii. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat) naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water)
Lane 9: Positive control (DNA extracted from yolk sacs of chicken embryos inoculated with C. burnetii) Results and Discussion

As expected, the O1-O2 fragment of the eukaryotic cells could be amplified after extraction of the total gDNA of goat placenta, mouse spleen or bovine milk contaminated with C. burnetii (Fig. 1). As the quantity of cells in milk is low and variable, the PCR product obtained with these samples is weak. In addition, the Trans1-Trans2 fragment from C. burnetii could also be amplified successfully in Trans-PCR (Fig. 2).

Thus, this kit can be used for the detection of C. burnetii in different samples such as placenta, spleen, milk or blood (data not shown). Similar results were found with spleens of mice contaminated with Chlamydia and treated with this kit (data not shown).

References

  1. Baca, O.G. and Paretsky, D. 1983. Q fever and Coxiella burnetii: a model for host-parasite interaction. Microbiol Rev 47: 127-149.
  2. Berri, M., Laroucau, K. and Rodolakis A. 2000. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol 72 (3-4): 285-93.
  3. Hoover, T.A., Vodkin, M.H. and Williams, J.C. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J Bacteriol 174(17): 5540-5548.
  4. Lorenz, H., Jger, C., Willems H. and Balger, G. 1998. PCR detection of C. burnetii from different clinical specimen, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol 64: 4234-4237.
  5. Raoult, D., Vestris, G. and Enea, M. 1990. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 28(11): 2482-2484.
  6. Willems, H., Thiele, D., Frhlich-Ritter, R. and Krauss, H. 1994. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). J Vet Med Ser B 41: 580-587.

'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:10/1/2014)... San Francisco, California (PRWEB) October 01, 2014 ... grant from the National Science Foundation to expand their ... approaches to build and modify DNA. The Small Business ... help commercialize the “j5” technology under exclusive license from ... the Joint BioEnergy Institute , an LBNL laboratory ...
(Date:10/1/2014)... , October 1, 2014 ... to software invited to engage around the theme, ,Commercial ...     Elsevier , ... products and services, will host a gathering of some ... issues and trends impacting healthcare today and in the ...
(Date:9/30/2014)... German . , ... demonstrated a new kind of building block for digital ... could be based on three-dimensional arrangements of nanometer-scale magnets ... the semiconductor industry CMOS fabrication of silicon chips ... at the University of Notre Dame are exploring "magnetic ...
(Date:9/30/2014)... Report Details Biosimilar drugs – ... Do you want to find sales potentials of ... for those biological drugs from 2014, helping you ... data, R&D trends, opportunities and selling prospects. In ... 2024 at overall world market, therapeutic class, molecule ...
Breaking Biology Technology:TeselaGen Receives $750k NSF SBIR Phase II Award 2TeselaGen Receives $750k NSF SBIR Phase II Award 3Elsevier Healthcare and Pharmaceutical Economics Conference 2014 To Convene Industry Leaders to Discuss Top Healthcare Business Issues 2Elsevier Healthcare and Pharmaceutical Economics Conference 2014 To Convene Industry Leaders to Discuss Top Healthcare Business Issues 3A new dimension for integrated circuits: 3-D nanomagnetic logic 2A new dimension for integrated circuits: 3-D nanomagnetic logic 3Biosimilars and Follow-On Biologics: World Industry and Market Prospects 2014-2024 2Biosimilars and Follow-On Biologics: World Industry and Market Prospects 2014-2024 3Biosimilars and Follow-On Biologics: World Industry and Market Prospects 2014-2024 4Biosimilars and Follow-On Biologics: World Industry and Market Prospects 2014-2024 5
... (Nasdaq: DNDN ) today announced significant ... of PROVENGE® (sipuleucel-T), the first autologous cellular immunotherapy ... metastatic castrate resistant (hormone refractory) prostate cancer (mCRPC). ... and Drug Administration (FDA) approved the Los Angeles ...
... JERICHO, N.Y., June 30, 2011 ( HCCS ) ... online healthcare compliance and competency training, today announced the ... Management System , SimPL - The Simple ... management features to the existing online training and eLearning ...
... The National Parkinson Foundation (NPF) has awarded more ... Through NPF,s individual investigators awards program, NPF is supporting work ... an advanced biomarker study, 2) a clinical trial to treat ... a treatment for sleep apnea in PD. "Each ...
Cached Biology Technology:Dendreon Announces Increased Capacity and Significant Reimbursement Decisions Supporting Broad Availability of PROVENGE 2Dendreon Announces Increased Capacity and Significant Reimbursement Decisions Supporting Broad Availability of PROVENGE 3Dendreon Announces Increased Capacity and Significant Reimbursement Decisions Supporting Broad Availability of PROVENGE 4HCCS Releases Classroom Management Features for Low Cost Learning Management System 2National Parkinson Foundation Awards More Than $1 Million for Research 2National Parkinson Foundation Awards More Than $1 Million for Research 3
(Date:9/30/2014)... MILFORD, Mass. , Sept. 30, 2014 ... process control solutions for the biotech and ... of its new RECONN Bioprocess Manager, an ... reporting solution geared towards bioprocess development laboratories. ... facilities have disparate bioreactor and analyzer systems. ...
(Date:9/30/2014)... HONG KONG , Sept. 30, 2014 Winners of ... The Economist Events, Innovation Summit scheduled to take place at the ... At the summit, the award winners will share their experiences and ... people who have made a proven innovation over the past decade, ... the night before the summit. It will be the ...
(Date:9/29/2014)... Plants have a symbiotic relationship with certain bacteria. ... and defend against invaders an important step ... Now, scientist have discovered that plants may package ... that sprouting plants are colonized from the beginning. ... presented their findings today at the 5th ASM ...
Breaking Biology News(10 mins):Spectra Automation Introduces RECONN Bioprocess Manager 2Hear from The Economist's 2014 Innovation Award Winners at Innovation Summit on October 10th in Hong Kong 2Hear from The Economist's 2014 Innovation Award Winners at Innovation Summit on October 10th in Hong Kong 3Hear from The Economist's 2014 Innovation Award Winners at Innovation Summit on October 10th in Hong Kong 4Hear from The Economist's 2014 Innovation Award Winners at Innovation Summit on October 10th in Hong Kong 5Hear from The Economist's 2014 Innovation Award Winners at Innovation Summit on October 10th in Hong Kong 6Hear from The Economist's 2014 Innovation Award Winners at Innovation Summit on October 10th in Hong Kong 7Plants prepackage beneficial microbes in their seeds 2
... to put a price tag on the natural world? A ... rise of a new concept ecosystem services to ... Nature. Academic Dr Marion Potschin, of the University,s Centre ... who have been investigating the ethical considerations of this new ...
... . , Biopesticides containing beneficial fungi are ... Department of Agriculture (USDA) scientists have shown a liquid ... "liquid culture fermentation," offers several benefits, including lower material ... fungi, including Isaria or Metarhizium , ...
... CALGARY Researchers in Calgary have launched the first gene therapy ... enzyme deficiency that can shorten the lifespan of people who have ... first remove a quantity of stem cells from a Fabry patient,s ... inserted into the stem cells using a specially engineered virus. During ...
Cached Biology News:Valuing nature is not enough 2New, cost-cutting approach to formulating pest-killing fungi 2Canada launches first gene therapy trial for Fabry disease 2Canada launches first gene therapy trial for Fabry disease 3
... developed for use with immunohistochemical (IHC) ... background staining due to endogenous peroxidase. ... with hydrogen peroxide. This reagent ... additional novel components to further quench ...
Rabbit polyclonal to Wilms Tumor Protein ( Abpromise for all tested applications). entrezGeneID: 7490 SwissProtID: P19544...
Ku80 Antibody Shipping Temperature: HOT Storage Temperature: -20C...
Request Info...
Biology Products: