Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit

Nathalie Arricau-Bouvery and Armel Souriau
INRA centre of TOURS, Unit de Pathologie Infectieuse et Immunologie, 37380 NOUZILLY FRANCE
Phone: (33) 0247427634, Fax: (33) 0247427779, e-mail: bouvery@tours.inra.fr Introduction

Coxiella burnetii, the etiologic agent of Q fever, is an obligate intracellular bacterium. The reservoirs are extensive but partially known, and include mammals, birds and arthropods. Farm animals (i.e., cattle, sheep, goats) are identified as principal sources of human infection 1. Routine diagnosis of Q fever in veterinary medicine is usually performed by Stamp staining of the placenta or serological tests. Isolation and quantitation of C. burnetii are difficult, time consuming and require confined level L3 laboratories. Detection of C. burnetii is possible by using cell culture (shell vial culture system), but essentially it is used in clinical practice 5. Polymerase chain reaction has become a useful tool for the detection of C. burnetii in biological samples 6. However, this necessitates the extraction of the genomic DNA of C. burnetii without purification of bacteria. Thus, the samples contain gDNA of the bacteria and the eukaryotic cells. Different methods are reported in the literature 2, 4, but the sensitivity is very low or the method is not adapted to samples containing blood.

In this article, we report that the Perfect gDNA Blood Mini Kit from Eppendorf is highly adapted to the C. burnetii gDNA extraction when the bacterium is present in goat placenta (blood), mouse spleen or milk.

Materials and Methods

Samples:

  1. Placenta (goat): the placenta was homogenized in sterile physiological buffer and is constituted essentially of blood.
  2. Spleen (mouse): the spleen was homogenized in sterile physiological buffer.
  3. Milk (bovine)
  4. Blood: the results found with blood provided by animals naturally infected with C. burnetii are the same as those found with placenta, but are not as strong. Indeed, animal blood is deficient in bacterial particles and its difficult to project if and when the bacteria is present in the blood. Thus, only results found with placenta are shown here and represent the results we could have found with blood.
DNA Extraction:

Total DNA was directly extracted from 20 l and 50 l of homogenized goat placenta naturally contaminated by C. burnetii (genome size: 2,103 kb), 10 l, 30 l and 50 l of homogenized mouse spleen (mouse injected intraperitoneally with C. burnetii) and 100 l of bovine milk contaminated by infective suspension of C. burnetii and containing 108 or 107 bacteria/ml). The extraction was carried out using the Eppendorf Perfect gDNA Blood Mini Kit as recommended in the manual with the exception of two steps: the lysis with Proteinase K was performed at 70C in a water bath over a thirty minute period (and could now be frozen at 20C before continuing the DNA extraction), and the final step: gDNA was eluted with 150 l of Elution Buffer.

PCR:

Two primers, Trans1 and Trans2, derived from a transposon-like repetitive region of the C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water) Fig. 2: Amplification of a 687 bp fragment of genomic DNA from Coxiella burnetii. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat) naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water)
Lane 9: Positive control (DNA extracted from yolk sacs of chicken embryos inoculated with C. burnetii) Results and Discussion

As expected, the O1-O2 fragment of the eukaryotic cells could be amplified after extraction of the total gDNA of goat placenta, mouse spleen or bovine milk contaminated with C. burnetii (Fig. 1). As the quantity of cells in milk is low and variable, the PCR product obtained with these samples is weak. In addition, the Trans1-Trans2 fragment from C. burnetii could also be amplified successfully in Trans-PCR (Fig. 2).

Thus, this kit can be used for the detection of C. burnetii in different samples such as placenta, spleen, milk or blood (data not shown). Similar results were found with spleens of mice contaminated with Chlamydia and treated with this kit (data not shown).

References

  1. Baca, O.G. and Paretsky, D. 1983. Q fever and Coxiella burnetii: a model for host-parasite interaction. Microbiol Rev 47: 127-149.
  2. Berri, M., Laroucau, K. and Rodolakis A. 2000. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol 72 (3-4): 285-93.
  3. Hoover, T.A., Vodkin, M.H. and Williams, J.C. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J Bacteriol 174(17): 5540-5548.
  4. Lorenz, H., Jger, C., Willems H. and Balger, G. 1998. PCR detection of C. burnetii from different clinical specimen, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol 64: 4234-4237.
  5. Raoult, D., Vestris, G. and Enea, M. 1990. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 28(11): 2482-2484.
  6. Willems, H., Thiele, D., Frhlich-Ritter, R. and Krauss, H. 1994. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). J Vet Med Ser B 41: 580-587.

'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:1/22/2015)...   Cypher Genomics, Inc., the leading genome ... SQNM ), the leading molecular diagnostics company, today ... prenatal tests (NIPT). Through this agreement, Sequenom will ... advance analysis of clinically-relevant fetal sub-chromosomal variants detected ...
(Date:12/24/2014)... Dec. 24, 2014  United Therapeutics Corporation (NASDAQ: ... MDT ) has submitted a pre-market approval application ... the use of Medtronic,s SynchroMed ® II implantable ... use with United Therapeutics, Remodulin ® (treprostinil) Injection ...
(Date:12/24/2014)... GMO corn cases filed across the United States, and ... being consolidated in a Kansas federal court for pretrial proceedings. ... Corn Litigation, MDL No. 2591 in the U.S. District Court ... GMO corn multidistrict litigation (MDL) has been handed over to ...
(Date:12/24/2014)... 23, 2014 The report provides ... definition, classification, application and industry overview. This report ... cost structure. Production is separated by regions, technology ... materials, equipment, downstream client survey, marketing channels, industry ...
Breaking Biology Technology:Cypher Genomics and Sequenom Announce Development Agreement 2Cypher Genomics and Sequenom Announce Development Agreement 3Cypher Genomics and Sequenom Announce Development Agreement 4United Therapeutics Announces Submission Of Pre-Market Approval Application For Implantable Drug Infusion System To Deliver Remodulin 2United Therapeutics Announces Submission Of Pre-Market Approval Application For Implantable Drug Infusion System To Deliver Remodulin 3United Therapeutics Announces Submission Of Pre-Market Approval Application For Implantable Drug Infusion System To Deliver Remodulin 4Carey Danis & Lowe Reports on Syngenta GMO Corn Transfer Order 2Worldwide Methyl Mercaptan Market 2015-2020 Forecasts on Development & Trends Now Available at ReportsnReports.com 2
... lead sponsorship of the International Genetically Engineered ... by the Massachusetts Institute of Technology (MIT). ... undergraduate teams representing more than 1,000 students ... America, and the U.S. to design and ...
... preliminary data,from a Phase II/III clinical trial of ... heart failure will be presented next,week at a ... Sessions 2008 in New Orleans., John R. ... Francisco, will present the data from the multicenter, ...
... Nov. 3 Verenium Corporation,(Nasdaq: VRNM ), ... and high-performance specialty enzymes, announced today that it,will ... November 10,2008 after market close. In conjunction with ... with live webcast on Monday, November 10 at ...
Cached Biology Technology: The MathWorks Sponsors iGEM Competition for Synthetic Biology at MIT : MATLAB and SimBiology Help Accelerate Design of Synthetic Biological Systems 2 The MathWorks Sponsors iGEM Competition for Synthetic Biology at MIT : MATLAB and SimBiology Help Accelerate Design of Synthetic Biological Systems 3Top-Line Preliminary Data From Phase II/III Study of Corthera's Relaxin in Acute Heart Failure to be Presented in Satellite Symposium at AHA Scientific Sessions 2008 2Verenium Corporation to Announce Third Quarter 2008 Financial Results 2Verenium Corporation to Announce Third Quarter 2008 Financial Results 3
(Date:12/24/2014)... , Dec. 23, 2014  Since its launch in December 2014, ... to eliminate the pain of trying to remember their usernames ... biometrics fused to their smartphones. To assist people who have ... the company that created 1U and focuses on redefining identity, ...
(Date:12/22/2014)... Dec. 22, 2014  The 2014 Holiday Season may be ... Market Intelligence reports that the long anticipated floodgates for ... intensifying demand for smart phones, tablets, and wearable mobile ... of 2.5 billion users with nearly 4.8 billion biometric ...
(Date:12/19/2014)... Dec. 18, 2014  23andMe, Inc., the leading personal genetics company, ... differences in genetic ancestry of individuals from across ... arrived more than four hundred years ago, the ... for peoples from different continents. This study illuminates how American ...
Breaking Biology News(10 mins):1U Offers Best Solution to the Username / Password Dilemma: For FREE! 21U Offers Best Solution to the Username / Password Dilemma: For FREE! 3First Season of Holiday Shopping with Mobile Biometric Payments Wraps Up With a Present for Biometrics Industry: A Rosy Forecast for More Than 2 Billion Users of 4.8 Billion Mobile Biometric Devices by 2020 223andMe Study Sketches Genetic Portrait of the United States 223andMe Study Sketches Genetic Portrait of the United States 323andMe Study Sketches Genetic Portrait of the United States 4
... Brown University, with lead partner Women & Infants ... five-year contract to expand its participation in the National ... child health. The National Institute of Child Health ... and Centers at the National Institutes of Health, announced ...
... discovery that counters prevailing thought, a study in mice ... involved in "fat-burning" can actually increase energy expenditure and ... week in the JBC, might lead to ... and other warm-blooded animals need to continually "burn fat" ...
... a keystone species, filling such an important niche in ... Scientists are finding, however, that sea otters can have ... alter the behavior of another top predator: the bald ... can reach heights of 250 feet and function much ...
Cached Biology News:Brown University and Women & Infants Hospital expand national children's study to Bristol County 2Brown University and Women & Infants Hospital expand national children's study to Bristol County 3Brown University and Women & Infants Hospital expand national children's study to Bristol County 4Making metabolism more inefficient can reduce obesity 2Decline in Alaskan sea otters affects bald eagles' diet 2Decline in Alaskan sea otters affects bald eagles' diet 3
... Magnetofection technology, SilenceMag is the most ... rapid and easy to use, SilenceMag ... Specifically designed for siRNA delivery, SilenceMag ... low doses of siRNA.,SilenceMag formulation gives ...
... DW4 liquid handling system from Molecular Devices ... in one instrument. The system handles a ... plate washing96-, 384- and 1536-welland is the ... DW4 has been optimized to dispense from ...
... Radiochemical Purity is >95%NEN Radiolabeled Ligands\n\nReceptor-related ... continual availability of new radiolabeled ligands selected ... offers a wide range of products and ... including over 400 state-of-the-art radioligands. If you ...
... Radiolabeled Ligands\n\nReceptor-related research has long been enabled ... ligands selected to keep pace with new ... products and services for receptor research and ... If you do not find exactly what ...
Biology Products: