Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit

Nathalie Arricau-Bouvery and Armel Souriau
INRA centre of TOURS, Unit de Pathologie Infectieuse et Immunologie, 37380 NOUZILLY FRANCE
Phone: (33) 0247427634, Fax: (33) 0247427779, e-mail: bouvery@tours.inra.fr Introduction

Coxiella burnetii, the etiologic agent of Q fever, is an obligate intracellular bacterium. The reservoirs are extensive but partially known, and include mammals, birds and arthropods. Farm animals (i.e., cattle, sheep, goats) are identified as principal sources of human infection 1. Routine diagnosis of Q fever in veterinary medicine is usually performed by Stamp staining of the placenta or serological tests. Isolation and quantitation of C. burnetii are difficult, time consuming and require confined level L3 laboratories. Detection of C. burnetii is possible by using cell culture (shell vial culture system), but essentially it is used in clinical practice 5. Polymerase chain reaction has become a useful tool for the detection of C. burnetii in biological samples 6. However, this necessitates the extraction of the genomic DNA of C. burnetii without purification of bacteria. Thus, the samples contain gDNA of the bacteria and the eukaryotic cells. Different methods are reported in the literature 2, 4, but the sensitivity is very low or the method is not adapted to samples containing blood.

In this article, we report that the Perfect gDNA Blood Mini Kit from Eppendorf is highly adapted to the C. burnetii gDNA extraction when the bacterium is present in goat placenta (blood), mouse spleen or milk.

Materials and Methods

Samples:

  1. Placenta (goat): the placenta was homogenized in sterile physiological buffer and is constituted essentially of blood.
  2. Spleen (mouse): the spleen was homogenized in sterile physiological buffer.
  3. Milk (bovine)
  4. Blood: the results found with blood provided by animals naturally infected with C. burnetii are the same as those found with placenta, but are not as strong. Indeed, animal blood is deficient in bacterial particles and its difficult to project if and when the bacteria is present in the blood. Thus, only results found with placenta are shown here and represent the results we could have found with blood.
DNA Extraction:

Total DNA was directly extracted from 20 l and 50 l of homogenized goat placenta naturally contaminated by C. burnetii (genome size: 2,103 kb), 10 l, 30 l and 50 l of homogenized mouse spleen (mouse injected intraperitoneally with C. burnetii) and 100 l of bovine milk contaminated by infective suspension of C. burnetii and containing 108 or 107 bacteria/ml). The extraction was carried out using the Eppendorf Perfect gDNA Blood Mini Kit as recommended in the manual with the exception of two steps: the lysis with Proteinase K was performed at 70C in a water bath over a thirty minute period (and could now be frozen at 20C before continuing the DNA extraction), and the final step: gDNA was eluted with 150 l of Elution Buffer.

PCR:

Two primers, Trans1 and Trans2, derived from a transposon-like repetitive region of the C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water) Fig. 2: Amplification of a 687 bp fragment of genomic DNA from Coxiella burnetii. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat) naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water)
Lane 9: Positive control (DNA extracted from yolk sacs of chicken embryos inoculated with C. burnetii) Results and Discussion

As expected, the O1-O2 fragment of the eukaryotic cells could be amplified after extraction of the total gDNA of goat placenta, mouse spleen or bovine milk contaminated with C. burnetii (Fig. 1). As the quantity of cells in milk is low and variable, the PCR product obtained with these samples is weak. In addition, the Trans1-Trans2 fragment from C. burnetii could also be amplified successfully in Trans-PCR (Fig. 2).

Thus, this kit can be used for the detection of C. burnetii in different samples such as placenta, spleen, milk or blood (data not shown). Similar results were found with spleens of mice contaminated with Chlamydia and treated with this kit (data not shown).

References

  1. Baca, O.G. and Paretsky, D. 1983. Q fever and Coxiella burnetii: a model for host-parasite interaction. Microbiol Rev 47: 127-149.
  2. Berri, M., Laroucau, K. and Rodolakis A. 2000. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol 72 (3-4): 285-93.
  3. Hoover, T.A., Vodkin, M.H. and Williams, J.C. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J Bacteriol 174(17): 5540-5548.
  4. Lorenz, H., Jger, C., Willems H. and Balger, G. 1998. PCR detection of C. burnetii from different clinical specimen, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol 64: 4234-4237.
  5. Raoult, D., Vestris, G. and Enea, M. 1990. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 28(11): 2482-2484.
  6. Willems, H., Thiele, D., Frhlich-Ritter, R. and Krauss, H. 1994. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). J Vet Med Ser B 41: 580-587.

'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:7/31/2014)... 31, 2014 According to a ... Dots Market - Global Industry Analysis, Size, Share, Growth, ... valued at USD 88.5 million in 2011, which is ... at a CAGR of 53.8% from 2013 to 2023. ... at  http://www.transparencymarketresearch.com/quantum-dots.html Increasing demand for energy ...
(Date:7/31/2014)... -- Research and Markets has announced the ... report to their offering. ... the genetic material or genomes of an organism. It ... discovery and development of diagnostic and therapeutic solutions for ... is supported by three major product segments: Instruments, Consumables, ...
(Date:7/31/2014)... Calif. (PRWEB) July 31, 2014 Held ... diagnosed patients with an overview of the disease and ... of drug side effects, as well as updates on ... grateful to Dr. Sandy Srinivas for organizing this educational ... of kidney cancer. “Sandy and her colleagues have put ...
(Date:7/31/2014)... BOTHELL, Wash. , July 31, 2014   ... a leading developer, manufacturer and marketer of proprietary clinical ... media and precision thermal shipping products ... Company,s second quarter 2014 financial results will be released ... will host a conference call and live webcast at ...
Breaking Biology Technology:Global Quantum Dots Market is Expected to Reach USD 8,246.8 Million in 2023: Transparency Market Research 2Global Quantum Dots Market is Expected to Reach USD 8,246.8 Million in 2023: Transparency Market Research 3Global Quantum Dots Market is Expected to Reach USD 8,246.8 Million in 2023: Transparency Market Research 4Global Genomics Market 2014-2018: Key Vendors are F. Hoffmann-La Roche, Life Technologies, Qiagen and Illumina 2BioLife Solutions to Report Financial Results for Second Quarter 2014 and Provide Business Update on August 7, 2014 2
... Gyeonggi Province, ST. LOUIS, Nov. 5 SAFC ... Sigma-Aldrich Group (Nasdaq: SIAL ),today announced that a ... Korea has been signed. The MoU signals the Company,s,intentions ... being built in the province for the supply and ...
... of second line HRPC patients on TPI 287 show clinical ... TPPH ) announced today financial results for,the third quarter ... third quarter of 2007 was $6.1 million, or $0.37,per share. ... of 2006 of,$3.6 million, or $0.22 per share. Included in ...
... 4 Scientists at Monsanto,Company working in collaboration ... approach to protect crops against insects, which,models a ... The,technology is expected to provide farmers with a ... another tool to support agriculture,s,mission of meeting the ...
Cached Biology Technology:SAFC Hitech(TM) Plans Further Expansion Into Asia 2SAFC Hitech(TM) Plans Further Expansion Into Asia 3Tapestry Reports Third Quarter 2007 Financial Results and Preliminary Data From Its Phase 2 Prostate Cancer Trial 2Tapestry Reports Third Quarter 2007 Financial Results and Preliminary Data From Its Phase 2 Prostate Cancer Trial 3Tapestry Reports Third Quarter 2007 Financial Results and Preliminary Data From Its Phase 2 Prostate Cancer Trial 4Tapestry Reports Third Quarter 2007 Financial Results and Preliminary Data From Its Phase 2 Prostate Cancer Trial 5Tapestry Reports Third Quarter 2007 Financial Results and Preliminary Data From Its Phase 2 Prostate Cancer Trial 6Tapestry Reports Third Quarter 2007 Financial Results and Preliminary Data From Its Phase 2 Prostate Cancer Trial 7Monsanto and Devgen Describe New Approach to Insect-Protection 2Monsanto and Devgen Describe New Approach to Insect-Protection 3
(Date:7/31/2014)... studies have shown that marine noise can affect animal ... the Universities of Bristol and Exeter and the cole ... demonstrated that boat noise stops embryonic development and increases ... the sea slug Stylocheilus striatus used in ... away and later feed on toxic alga but this ...
(Date:7/30/2014)... A deep-sea octopus protected and tended her eggs until ... published July 30, 2014 in the open-access journal ... Aquarium Research Institute and colleagues. , Octopuses typically have ... females protect and take care of their fertilized eggs ... eggs for 1 to 3 months, but little is ...
(Date:7/30/2014)... University of Helsinki and the Universitat Autnoma de Barcelona ... changes which have taken millions of years to occur. ... of mice teeth, induced in the laboratory, scientists have ... observed in the fossil registry of rodent species which ... To modify the development of their teeth, the team ...
Breaking Biology News(10 mins):Boat noise impacts development and survival of sea hares 2Deep-sea octopus has longest-known egg-brooding period 2Scientists reproduce evolutionary changes by manipulating embryonic development of mice 2
... - Everyone is special in their own unique way. From ... identical. This means that DNA for each individual contains variants ... population. Some gene variations are actually genetic deletions, ... are likely to have important effects on gene function and, ...
... has often been associated with improving people,s health, but a ... hormones in a way that reduces stress. Unmarried people ... to stress as do married people, said Dario Maestripieri, Professor ... lead author of the study, published in the current issue ...
... has proved effective in preventing fouling of ship bottoms. Researchers ... that causes the barnacle to react to the substance, opening ... both on barnacles and on the environment. Fouling of ... leisure craft as well as large cargo ships. The University ...
Cached Biology News:Developmental problems: Some exist in the genes 2Marriage and committed romance reduce stress-related hormone production 2Gene that causes barnacles to avoid ship hulls identified 2