Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit

Nathalie Arricau-Bouvery and Armel Souriau
INRA centre of TOURS, Unit de Pathologie Infectieuse et Immunologie, 37380 NOUZILLY FRANCE
Phone: (33) 0247427634, Fax: (33) 0247427779, e-mail: bouvery@tours.inra.fr Introduction

Coxiella burnetii, the etiologic agent of Q fever, is an obligate intracellular bacterium. The reservoirs are extensive but partially known, and include mammals, birds and arthropods. Farm animals (i.e., cattle, sheep, goats) are identified as principal sources of human infection 1. Routine diagnosis of Q fever in veterinary medicine is usually performed by Stamp staining of the placenta or serological tests. Isolation and quantitation of C. burnetii are difficult, time consuming and require confined level L3 laboratories. Detection of C. burnetii is possible by using cell culture (shell vial culture system), but essentially it is used in clinical practice 5. Polymerase chain reaction has become a useful tool for the detection of C. burnetii in biological samples 6. However, this necessitates the extraction of the genomic DNA of C. burnetii without purification of bacteria. Thus, the samples contain gDNA of the bacteria and the eukaryotic cells. Different methods are reported in the literature 2, 4, but the sensitivity is very low or the method is not adapted to samples containing blood.

In this article, we report that the Perfect gDNA Blood Mini Kit from Eppendorf is highly adapted to the C. burnetii gDNA extraction when the bacterium is present in goat placenta (blood), mouse spleen or milk.

Materials and Methods

Samples:

  1. Placenta (goat): the placenta was homogenized in sterile physiological buffer and is constituted essentially of blood.
  2. Spleen (mouse): the spleen was homogenized in sterile physiological buffer.
  3. Milk (bovine)
  4. Blood: the results found with blood provided by animals naturally infected with C. burnetii are the same as those found with placenta, but are not as strong. Indeed, animal blood is deficient in bacterial particles and its difficult to project if and when the bacteria is present in the blood. Thus, only results found with placenta are shown here and represent the results we could have found with blood.
DNA Extraction:

Total DNA was directly extracted from 20 l and 50 l of homogenized goat placenta naturally contaminated by C. burnetii (genome size: 2,103 kb), 10 l, 30 l and 50 l of homogenized mouse spleen (mouse injected intraperitoneally with C. burnetii) and 100 l of bovine milk contaminated by infective suspension of C. burnetii and containing 108 or 107 bacteria/ml). The extraction was carried out using the Eppendorf Perfect gDNA Blood Mini Kit as recommended in the manual with the exception of two steps: the lysis with Proteinase K was performed at 70C in a water bath over a thirty minute period (and could now be frozen at 20C before continuing the DNA extraction), and the final step: gDNA was eluted with 150 l of Elution Buffer.

PCR:

Two primers, Trans1 and Trans2, derived from a transposon-like repetitive region of the C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water) Fig. 2: Amplification of a 687 bp fragment of genomic DNA from Coxiella burnetii. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat) naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water)
Lane 9: Positive control (DNA extracted from yolk sacs of chicken embryos inoculated with C. burnetii) Results and Discussion

As expected, the O1-O2 fragment of the eukaryotic cells could be amplified after extraction of the total gDNA of goat placenta, mouse spleen or bovine milk contaminated with C. burnetii (Fig. 1). As the quantity of cells in milk is low and variable, the PCR product obtained with these samples is weak. In addition, the Trans1-Trans2 fragment from C. burnetii could also be amplified successfully in Trans-PCR (Fig. 2).

Thus, this kit can be used for the detection of C. burnetii in different samples such as placenta, spleen, milk or blood (data not shown). Similar results were found with spleens of mice contaminated with Chlamydia and treated with this kit (data not shown).

References

  1. Baca, O.G. and Paretsky, D. 1983. Q fever and Coxiella burnetii: a model for host-parasite interaction. Microbiol Rev 47: 127-149.
  2. Berri, M., Laroucau, K. and Rodolakis A. 2000. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol 72 (3-4): 285-93.
  3. Hoover, T.A., Vodkin, M.H. and Williams, J.C. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J Bacteriol 174(17): 5540-5548.
  4. Lorenz, H., Jger, C., Willems H. and Balger, G. 1998. PCR detection of C. burnetii from different clinical specimen, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol 64: 4234-4237.
  5. Raoult, D., Vestris, G. and Enea, M. 1990. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 28(11): 2482-2484.
  6. Willems, H., Thiele, D., Frhlich-Ritter, R. and Krauss, H. 1994. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). J Vet Med Ser B 41: 580-587.

'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:12/24/2014)... December 23, 2014 The ... such as its definition, classification, application and ... specification, manufacturing process, and product cost structure. ... applications. The analysis also covers upstream raw ... industry development trend and proposals. In the ...
(Date:12/24/2014)... 2014 Vermillion, Inc. (Nasdaq:   VRML), ... announced today that investors including Oracle Investment Management, ... and several Vermillion directors have agreed to purchase ... common stock and warrants to purchase unregistered shares ... Under the terms of the ...
(Date:12/22/2014)... Brussels (PRWEB) December 22, 2014 The ... the global leader of technical training across the life ... Clinical Data Management (SCDM) to provide the organization's ... certification programs —providing access to the more than 350 ... SCDM members with 10% off when registering for a ...
(Date:12/22/2014)... Dec. 22, 2014  ( www.competitivehealth.com ) — Competitive ... medical bill review and advocacy service, has signed an ... WellCard Savings discount health services marketplace. 63% ... more than they expected to pay. As part of ... costs, WellCard Savings is pleased to offer medical bill ...
Breaking Biology Technology:Worldwide Methyl Mercaptan Market 2015-2020 Forecasts on Development & Trends Now Available at ReportsnReports.com 2Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 2Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 3Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 4Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 5CfPIE Announces Partnership with the Society for Clinical Data Management 2CfPIE Announces Partnership with the Society for Clinical Data Management 3WellCard Savings Announces CoPatient Medical Bill Review Service for Members 2
... chemists have developed a new way to make transistors ... integrated into high-performance computer chips to increase their speed ... chips when transistors are packed together tightly. , For ... Dai, the J. G. Jackson and C. J. Wood ...
... research institute to aid in successful mid-career changes, ... http://www.biocareercenter.com ) an online job board and careers tool ... who has developed Career Navigator -- a new product ... their fields with success --,to launch this new online ...
... May 28 The automation of,transaction-based processing ... in the United States. Foresight Corporation of ... and scale of installations of Transaction,Insight(R) - ... Transaction automation techniques enable healthcare organizations ...
Cached Biology Technology:Carbon nanoribbons could make smaller, speedier computer chips 2Online Career Service Turns Focus to 'Switching Gears' 2New Trend Sweeping Nation's Health Plans: Transaction Automation 2
(Date:11/21/2014)... , November 18, 2014 According ... Market by Systems (Video, RFID, Access Control, Intrusion Detection, ... Hotels, Banks, Government), Component Service Geography - Global Forecasts ... Market is projected to be around $25 Billion in ... 2020, growing at a CAGR of 8.69%. ...
(Date:11/21/2014)... , Nov. 20, 2014 Strict laws against ... are piloting the North American and European automotive sector ... growing, gesture recognition systems that are intuitive and able ... in the industry. New analysis from ... Recognition Market in Europe and ...
(Date:11/21/2014)... 20, 2014   Atmel® Corporation (NASDAQ: ... and touch technology solutions, today launched the industry,s first ... the widest V cc range from 1.7V to ... faster I 2 C bus communication speeds, and are ... making them ideal for consumer, industrial, computer, and medical ...
Breaking Biology News(10 mins):Industrial Security Systems Market Worth $38 Billion by 2020 2Industrial Security Systems Market Worth $38 Billion by 2020 3Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 2Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 3Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 4Atmel Launches Industry's First Wide-V(cc) Low-Power Temperature Sensor Family 2Atmel Launches Industry's First Wide-V(cc) Low-Power Temperature Sensor Family 3Atmel Launches Industry's First Wide-V(cc) Low-Power Temperature Sensor Family 4
... severed nerves could result in patients recovering in days or ... cellular mechanism similar to that used by many invertebrates to ... in the Journal of Neuroscience Research . "We ... minutes so that the behavior they control can be partially ...
... that make up half the biomass in the oceans ... over, mostly remain enigmatic. A few abundant groups have ... of the rest remain mysterious. Understanding how the ... is like trying to understand the solar system when ...
... fertile, excite our most basic urges, and as scientists have ... from women. But how? Now a team of scientists ... many genes influenced by the male and female sex hormones ... of male and female behaviors in mice. The UCSF ...
Cached Biology News:New procedure repairs severed nerves in minutes, restoring limb use in days or weeks 2Scientists coax shy microorganisms to stand out in a crowd 2Scientists coax shy microorganisms to stand out in a crowd 3Male and female behavior deconstructed 2Male and female behavior deconstructed 3Male and female behavior deconstructed 4
Prepared in distilled water....
in vitro Translation, Accessory Products...
... The Zero Blunt TOPO ... Sequencing is designed for ... of blunt-end PCR products. ... 5-minute TOPO Cloning and ...
... Zero Blunt TOPO PCR ... is designed for cloning ... blunt-end PCR products. The ... TOPO Cloning and greater ...
Biology Products: