Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit

Nathalie Arricau-Bouvery and Armel Souriau
INRA centre of TOURS, Unit de Pathologie Infectieuse et Immunologie, 37380 NOUZILLY FRANCE
Phone: (33) 0247427634, Fax: (33) 0247427779, e-mail: bouvery@tours.inra.fr Introduction

Coxiella burnetii, the etiologic agent of Q fever, is an obligate intracellular bacterium. The reservoirs are extensive but partially known, and include mammals, birds and arthropods. Farm animals (i.e., cattle, sheep, goats) are identified as principal sources of human infection 1. Routine diagnosis of Q fever in veterinary medicine is usually performed by Stamp staining of the placenta or serological tests. Isolation and quantitation of C. burnetii are difficult, time consuming and require confined level L3 laboratories. Detection of C. burnetii is possible by using cell culture (shell vial culture system), but essentially it is used in clinical practice 5. Polymerase chain reaction has become a useful tool for the detection of C. burnetii in biological samples 6. However, this necessitates the extraction of the genomic DNA of C. burnetii without purification of bacteria. Thus, the samples contain gDNA of the bacteria and the eukaryotic cells. Different methods are reported in the literature 2, 4, but the sensitivity is very low or the method is not adapted to samples containing blood.

In this article, we report that the Perfect gDNA Blood Mini Kit from Eppendorf is highly adapted to the C. burnetii gDNA extraction when the bacterium is present in goat placenta (blood), mouse spleen or milk.

Materials and Methods

Samples:

  1. Placenta (goat): the placenta was homogenized in sterile physiological buffer and is constituted essentially of blood.
  2. Spleen (mouse): the spleen was homogenized in sterile physiological buffer.
  3. Milk (bovine)
  4. Blood: the results found with blood provided by animals naturally infected with C. burnetii are the same as those found with placenta, but are not as strong. Indeed, animal blood is deficient in bacterial particles and its difficult to project if and when the bacteria is present in the blood. Thus, only results found with placenta are shown here and represent the results we could have found with blood.
DNA Extraction:

Total DNA was directly extracted from 20 l and 50 l of homogenized goat placenta naturally contaminated by C. burnetii (genome size: 2,103 kb), 10 l, 30 l and 50 l of homogenized mouse spleen (mouse injected intraperitoneally with C. burnetii) and 100 l of bovine milk contaminated by infective suspension of C. burnetii and containing 108 or 107 bacteria/ml). The extraction was carried out using the Eppendorf Perfect gDNA Blood Mini Kit as recommended in the manual with the exception of two steps: the lysis with Proteinase K was performed at 70C in a water bath over a thirty minute period (and could now be frozen at 20C before continuing the DNA extraction), and the final step: gDNA was eluted with 150 l of Elution Buffer.

PCR:

Two primers, Trans1 and Trans2, derived from a transposon-like repetitive region of the C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water) Fig. 2: Amplification of a 687 bp fragment of genomic DNA from Coxiella burnetii. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat) naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water)
Lane 9: Positive control (DNA extracted from yolk sacs of chicken embryos inoculated with C. burnetii) Results and Discussion

As expected, the O1-O2 fragment of the eukaryotic cells could be amplified after extraction of the total gDNA of goat placenta, mouse spleen or bovine milk contaminated with C. burnetii (Fig. 1). As the quantity of cells in milk is low and variable, the PCR product obtained with these samples is weak. In addition, the Trans1-Trans2 fragment from C. burnetii could also be amplified successfully in Trans-PCR (Fig. 2).

Thus, this kit can be used for the detection of C. burnetii in different samples such as placenta, spleen, milk or blood (data not shown). Similar results were found with spleens of mice contaminated with Chlamydia and treated with this kit (data not shown).

References

  1. Baca, O.G. and Paretsky, D. 1983. Q fever and Coxiella burnetii: a model for host-parasite interaction. Microbiol Rev 47: 127-149.
  2. Berri, M., Laroucau, K. and Rodolakis A. 2000. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol 72 (3-4): 285-93.
  3. Hoover, T.A., Vodkin, M.H. and Williams, J.C. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J Bacteriol 174(17): 5540-5548.
  4. Lorenz, H., Jger, C., Willems H. and Balger, G. 1998. PCR detection of C. burnetii from different clinical specimen, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol 64: 4234-4237.
  5. Raoult, D., Vestris, G. and Enea, M. 1990. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 28(11): 2482-2484.
  6. Willems, H., Thiele, D., Frhlich-Ritter, R. and Krauss, H. 1994. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). J Vet Med Ser B 41: 580-587.

'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:11/27/2014)... November 27, 2014 Spartan Bioscience today ... Food and Drug Safety (MFDS) regulatory approval for its ... genetic results in less than 60 minutes from a ... as an aid for doctors to determine therapeutic strategies ... These include some of the world’s most commonly prescribed ...
(Date:11/27/2014)... England , November 27, 2014 ... online on ScienceDirect   Elsevier , ... products and solutions, is pleased to announce the launch ... . The launch of ... the rapid advances at the forefront of applied sciences ...
(Date:11/27/2014)... EDINBURGH , November 27, 2014 ... on revolutionising the management of tooth decay, today ... study of its Calcivis® Caries Activity Imaging System. ... is a sophisticated medical device and consumable combination ... dental caries (tooth decay). It involves a unique, ...
(Date:11/27/2014)... Massachusetts, USA (PRWEB) November 26, 2014 ... more accuracy, additive systems to enable 3D manufacture at ... analyzing road conditions are among finalists in nine categories ... . The awards are sponsored by SPIE, the ... Photonics Media . , Winners will be announced by ...
Breaking Biology Technology:Spartan Bioscience Receives Korean Regulatory Approval for First Rapid DNA Test of Mutations Affecting Metabolism of Common Drugs 2Spartan Bioscience Receives Korean Regulatory Approval for First Rapid DNA Test of Mutations Affecting Metabolism of Common Drugs 3Elsevier Announces the Launch of a New Journal: Extreme Mechanics Letters 2Elsevier Announces the Launch of a New Journal: Extreme Mechanics Letters 3Calcivis Completes Clinical Study of Novel Caries Activity Imaging System 2Calcivis Completes Clinical Study of Novel Caries Activity Imaging System 3Finalists Named for 2015 Prism Awards for Photonics Innovation 2Finalists Named for 2015 Prism Awards for Photonics Innovation 3Finalists Named for 2015 Prism Awards for Photonics Innovation 4Finalists Named for 2015 Prism Awards for Photonics Innovation 5
... 6 NEXCORE Technology, Inc., a,world-class original equipment ... with GI Supply of Camp Hill, Pa, for ... Wand is a portable,device that uses endoscopic cryotherapy ... tract in patients resistant to conventional,endoscopic therapy., ...
... SOUTHAMPTON, Pa., Oct. 6 Environmental,Tectonics Corporation,s (Amex: ... Division today announced the sale of two (2) ... Center, Livingston,NJ., ETC is delighted to work ... nonsectarian hospital. The 597-bed institution,is one of the ...
... Realty Trust, Inc.,(NYSE: BMR ) today announced ... over-allotment option in full to purchase an additional,1,125,000 ... previously,announced offering that priced on October 1, 2008. ... stock, raising net proceeds of,approximately $212.4 million after ...
Cached Biology Technology:NEXCORE Technology Selected to Manufacture New Endoscopic Cryotherapy Device 2Environmental Tectonics Corporation Announces the Placement of Two Monoplace Hyperbaric Chambers at Saint Barnabas Medical Center in New Jersey 2Environmental Tectonics Corporation Announces the Placement of Two Monoplace Hyperbaric Chambers at Saint Barnabas Medical Center in New Jersey 3Environmental Tectonics Corporation Announces the Placement of Two Monoplace Hyperbaric Chambers at Saint Barnabas Medical Center in New Jersey 4BioMed Realty Trust Announces Exercise of Over-Allotment Option 2BioMed Realty Trust Announces Exercise of Over-Allotment Option 3
(Date:11/21/2014)... 2014 According to a new ... (Video, RFID, Access Control, Intrusion Detection, Parking Management, Under ... Component Service Geography - Global Forecasts to 2020", published ... to be around $25 Billion in 2014 and is ... a CAGR of 8.69%. Browse 116 market ...
(Date:11/21/2014)... 2014  Earlier this year Donald Spector , ... one of the most prolific inventors in the world, ... from Smartphones to third party agencies. Spector envisioned this ... of the earliest known patents in this area. Now ... military, child care, elder care and hospital applications. This ...
(Date:11/21/2014)... Strict laws against distracted driving and the ... American and European automotive sector towards gesture recognition technologies. ... that are intuitive and able to retrieve information with ... New analysis from Frost & Sullivan,s Strategic ... Europe and North America ...
Breaking Biology News(10 mins):Industrial Security Systems Market Worth $38 Billion by 2020 2Industrial Security Systems Market Worth $38 Billion by 2020 3Patented Biosensor Wearable Technology Provides a More Civilized Method of Quarantine 2Patented Biosensor Wearable Technology Provides a More Civilized Method of Quarantine 3Patented Biosensor Wearable Technology Provides a More Civilized Method of Quarantine 4Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 2Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 3Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 4
... was the credo of early 20th century architects making design ... biologists may be turning that on its head. New research* ... and Technology (NIST) reinforces the idea that stem cells can ... by controlling their shape. The results may be important to ...
... of Health (NIH) has awarded a five-year $23.2 million ... and the University of Medicine and Dentistry of New ... research aimed at developing drug products that could be ... Members of the Environmental and Occupational Health Sciences ...
... A protein critical in heart development may also play ... by investigators from Vanderbilt-Ingram Cancer Center and the Vanderbilt Eye ... which also is key in regulating corneal cells ... , The study, appearing in the October issue of ...
Cached Biology News:Shaping up: Controlling a stem cell's form can determine its fate 2Rutgers, UMDNJ receive $23 million to develop antidotes for chemical weapons attacks 2Protein found in heart may be target for colon cancer therapies 2Protein found in heart may be target for colon cancer therapies 3
Full service including gene cloning, protien expression and purification of 1 liter culture....
Superior homology search software - in all the flavours of blast, with increased sensitivity and speed...
Protein 3D structure prediction, via threading. Easy to use....
... (3 per pack), 1. One ... processing.Automated staining of Coomassie Blue or ... acid analysis.Prepares blots for high sensitivity ... of protocol, solution, volume, and processing ...
Biology Products: