Navigation Links
Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

corresponding unstained 10 m thick section using a micromanipulator (Narishige, Japan). For the aspiration of the lesions or morphologically normal cells capillaries of 1025 m diameter were used. The section was overlaid with TE, pH 8.0 (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). Aspiration only of the buffer served as contamination control. The aspirated cells/buffer were transferred to 5 l proteinase K digestion buffer (20 g proteinase K/ml in 10 mM Tris/HCl, 0.5% Nonidet P40) in PCR reaction vials. Digestion was performed for 10 minutes at 55 C to demask the DNA followed by an inactivation of the proteinase K (15 minutes at 96 C). To amplify the K-ras DNA PCR buffer was added to a final concentration of 12 mM Tris/HCl, pH 8.0, 50 mM KCl, 0.1% Nonidet, 0.2 mM each dNTP and 2 mM MgCl2. The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C, 40s 58 C, 30s 70 C). The final extension was 5 minutes at 70 C. PCR products were analyzed via a constant denaturing gel electrophoresis (CDGE) using the DCode universal mutation detection system (Bio-Rad, Germany). Gels contained 35% denaturant, 1x TAE, 7.5% polyacrylamide (30:1) and were run for 240 minutes at 200 V, 60 C and silver stained. For sequencing, the deviant bands were cut out of the gel and the DNA was eluted by soaking in TE. After reamplification and TA cloning (Invitrogen, The Netherlands) several clones were sequenced (ABI PRISM Dye Terminator Cycle Sequencing kit/
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins
2. A New PCR-based Mycoplasma Detection Method
3. HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
4. Detection and Identification of Phosphorylation Sites in Proteins Using LC/MS/MS with Neutral Fragment Loss Mapping
5. Detection of mRNAs on Cryosections of the Cardiovascular System Using DIG-Labeled RNA Probes
6. Gene Expression Arrays: Highly Sensitive Detection of Expression Patterns with Improved Tools for Target Amplification
7. The DIG System Nonradioactive and Highly Sensitive Detection of Nucleic Acids
8. Quantitative Measurement of Cell Proliferation Using the BrdU ELISA: A Comparison Between Colorimetric and Chemiluminescent Detection
9. Quantification of Nucleosomes in Serum by the Cell Death Detection ELISAplus
10. A Further Step in Understanding Apoptosis Direct Detection of PARP Cleavage
11. In Situ Cell Death Detection Kit
Post Your Comments:
(Date:9/30/2014)... The overall research objective was to ... and use. Most researchers outsource NGS technologies; however, ... within the next 12 months. Data accuracy and ... sequencing instruments. Disease-related research is the dominant use ... to surge, with half of the respondents planning ...
(Date:9/30/2014)... MA (PRWEB) September 30, 2014 ... (UC) and collaboration company is dedicated to supporting ... connectivity needs. Julie Power, a carrier ... to ensure collaboration solutions stays connected and productive ... to the increased movement of businesses to cloud ...
(Date:9/30/2014)... 30, 2014 UFP Technologies, a ... packaging has recently introduced a custom insulated shipping ... . The new insulated shipper solves the issue ... process. UFP Technologies’ BioShell is a universal storage ... storage, handling and shipping. The insulated shipper keeps ...
(Date:9/30/2014)... September 30, 2014 The ... IACRN), a non-profit organization based in Pittsburgh, Pennsylvania, ... and Safety (ACRES), a Massachusetts non-profit charitable ... alliance agreement, setting the stage for multiple collaborative ... clinical research quality and safety through specialized nursing ...
Breaking Biology Technology:Global Next-generation Sequencing Trends 2SoundConnect Expands Carrier Services Division 2UFP Technologies Introduces Insulated Shipping Container For Bulk Drug Transportation 2UFP Technologies Introduces Insulated Shipping Container For Bulk Drug Transportation 3IACRN and ACRES to Support Clinical Research Nurses 2IACRN and ACRES to Support Clinical Research Nurses 3
... Calif., Sept. 21 VaxGen,Inc. (Pink Sheets: VXGN) ... and Exchange Commission (SEC) its Quarterly Report on ... The report can be found at the link,titled ... VaxGen,s web site,at http://www.vaxgen.com . (Logo: ...
... for marketing, NEW YORK, Sept. 21 Small ... and education for the,small bone and joint sector of ... been cleared by the FDA for marketing in the ... implanted, degradable,spacers to four applications with two others planned ...
... Inc. (Nasdaq:,CEPH) today announced that it has submitted ... and Drug Administration (FDA) requesting approval of,TREANDA(R) (bendamustine ... leukemia (CLL). CLL is a slowly progressing blood ... cases diagnosed every year in,the United States, according ...
Cached Biology Technology:VaxGen Files First Quarter 2007 Financials 2Small Bone Innovations Introduces the Artelon(R) STT Spacer to Increase Treatment Options for Thumb Arthritis 2Small Bone Innovations Introduces the Artelon(R) STT Spacer to Increase Treatment Options for Thumb Arthritis 3Small Bone Innovations Introduces the Artelon(R) STT Spacer to Increase Treatment Options for Thumb Arthritis 4Small Bone Innovations Introduces the Artelon(R) STT Spacer to Increase Treatment Options for Thumb Arthritis 5Cephalon Submits New Drug Application for TREANDA for the Treatment of Chronic Lymphocytic Leukemia 2Cephalon Submits New Drug Application for TREANDA for the Treatment of Chronic Lymphocytic Leukemia 3Cephalon Submits New Drug Application for TREANDA for the Treatment of Chronic Lymphocytic Leukemia 4
(Date:9/29/2014)... A University of Texas at Arlington research team says ... built in their lab could open doors for homeland ... be published in the Oct. 1 issue of ... and his co-authors describe a new method to fabricate ... and oxygen until a transparent ceramic is formed. ...
(Date:9/29/2014)... $6 million grant for clinical research and education ... safe and effective treatments for cocaine addiction. , ... of Health, National Institute on Drug Abuse, will ... Cocaine Use Disorder to oversee preclinical and early ... forward with more expensive large-scale clinical trials. , ...
(Date:9/29/2014)... For decades, planetary geologists have speculated that glaciers ... 2000-mile-long chasm that constitutes the Grand Canyon of ... that might have been carved by past glaciers ... observations have remained highly controversial and contested. ... College and the Freie Universitaet Berlin has identified ...
Breaking Biology News(10 mins):UT Arlington researchers develop new transparent nanoscintillators for radiation detection 2UT Arlington researchers develop new transparent nanoscintillators for radiation detection 3New VCU center to target cocaine addiction 2Glaciers in the Grand Canyon of Mars? 2Glaciers in the Grand Canyon of Mars? 3Glaciers in the Grand Canyon of Mars? 4Glaciers in the Grand Canyon of Mars? 5Glaciers in the Grand Canyon of Mars? 6Glaciers in the Grand Canyon of Mars? 7Glaciers in the Grand Canyon of Mars? 8Glaciers in the Grand Canyon of Mars? 9
... bacteria to become resistant to antibiotics as well as ... January issue of Microbiology . The findings could ... is managed in hospital settings. Researchers from the ... adding increasing amounts of disinfectant to laboratory cultures of ...
... first time that insects, like mammals, use vision rather than ... high-speed video cameras technology the BBC uses to capture ... desert locusts stepping along the rungs of a miniature ladder. ... perform complex tasks, such as visually-guided limb control, usually associated ...
... study recently completed in the gulf coast of Alaska by ... disappears, the production and export of high- quality food from ... could have serious consequences for marine food webs. , The ... matter to the marine environment," was recently published in the ...
Cached Biology News:Disinfectants may promote growth of superbugs 2Ladder-walking locusts show big brains aren't always best 2Glacial watersheds may contribute to oceanic food web 2
TNM-FH Insect Medium 1 liter...
IHC Polymer Detection Kit (Rabbit DAB)150 slides...
Performance, mycoplasma, virus, and endotoxin tested. Collected from calves 14 days old or less...
... PureLink PCR Purification Kits provide rapid ... enzymes, short-failed PCR products, and salts from ... bind/wash/elute procedure:, provides two Binding Buffer ... bp* , can be performed in either ...
Biology Products: