Navigation Links
Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

corresponding unstained 10 m thick section using a micromanipulator (Narishige, Japan). For the aspiration of the lesions or morphologically normal cells capillaries of 1025 m diameter were used. The section was overlaid with TE, pH 8.0 (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). Aspiration only of the buffer served as contamination control. The aspirated cells/buffer were transferred to 5 l proteinase K digestion buffer (20 g proteinase K/ml in 10 mM Tris/HCl, 0.5% Nonidet P40) in PCR reaction vials. Digestion was performed for 10 minutes at 55 C to demask the DNA followed by an inactivation of the proteinase K (15 minutes at 96 C). To amplify the K-ras DNA PCR buffer was added to a final concentration of 12 mM Tris/HCl, pH 8.0, 50 mM KCl, 0.1% Nonidet, 0.2 mM each dNTP and 2 mM MgCl2. The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C, 40s 58 C, 30s 70 C). The final extension was 5 minutes at 70 C. PCR products were analyzed via a constant denaturing gel electrophoresis (CDGE) using the DCode universal mutation detection system (Bio-Rad, Germany). Gels contained 35% denaturant, 1x TAE, 7.5% polyacrylamide (30:1) and were run for 240 minutes at 200 V, 60 C and silver stained. For sequencing, the deviant bands were cut out of the gel and the DNA was eluted by soaking in TE. After reamplification and TA cloning (Invitrogen, The Netherlands) several clones were sequenced (ABI PRISM Dye Terminator Cycle Sequencing kit/
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins
2. A New PCR-based Mycoplasma Detection Method
3. HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
4. Detection and Identification of Phosphorylation Sites in Proteins Using LC/MS/MS with Neutral Fragment Loss Mapping
5. Detection of mRNAs on Cryosections of the Cardiovascular System Using DIG-Labeled RNA Probes
6. Gene Expression Arrays: Highly Sensitive Detection of Expression Patterns with Improved Tools for Target Amplification
7. The DIG System Nonradioactive and Highly Sensitive Detection of Nucleic Acids
8. Quantitative Measurement of Cell Proliferation Using the BrdU ELISA: A Comparison Between Colorimetric and Chemiluminescent Detection
9. Quantification of Nucleosomes in Serum by the Cell Death Detection ELISAplus
10. A Further Step in Understanding Apoptosis Direct Detection of PARP Cleavage
11. In Situ Cell Death Detection Kit
Post Your Comments:
(Date:4/21/2015)... (PRWEB) April 21, 2015 Contract Research Organization ... plans to relocate into a new 41,500 ft2 facility. ... headquarters, currently located at 16825 W. 116th St. in Lenexa, ... half times the customized laboratory space, will remain in the ... company was founded more than twenty years ago. Remaining ...
(Date:4/21/2015)... 2015 AbilTo, Inc., the nation,s leading digital ... has been accepted as a presentation to be included ... place on June 5-6, 2015 in Boston, Massachusetts ... Diabetes Association, the cost of diabetes to the American ... result of increased inpatient, outpatient, and pharmacy costs, the ...
(Date:4/21/2015)... 2015 Ampio Pharmaceuticals, Inc. (NYSE MKT: AMPE) ... on Thursday, April 23, 4:30 p.m. ET. Participants are ... Investor call information: U.S./ ... toll number: (925) 418-7845 Participant Passcode: 32888538 ... Amirkiai , tina.amirkiai@fleishman.com . Access will ...
(Date:4/21/2015)... , April 21, 2015  Tute Genomics, a leading ... of Josh Forsythe as VP of Marketing. Mr. ... witnessed a significant expansion in its commercial operations over the ... " Josh Forsythe is a tremendous addition ... MD MBA, CEO of Tute Genomics. "Josh,s vast experience commercializing ...
Breaking Biology Technology:XenoTech Plans Expansion to New Global Headquarters after Impressive Revenue Growth in 2014 2XenoTech Plans Expansion to New Global Headquarters after Impressive Revenue Growth in 2014 3AbilTo To Present at the 2015 American Diabetes Association Annual Meeting on Remote Delivery of Behavioral Change Therapy 2AbilTo To Present at the 2015 American Diabetes Association Annual Meeting on Remote Delivery of Behavioral Change Therapy 3Ampio Announces Investor Call on Thursday, April 23, 4:30 p.m. ET 2Tute Genomics Continues Expansion of Genomic Medicine Commercial Operations; Appoints Josh Forsythe as New VP of Marketing 2Tute Genomics Continues Expansion of Genomic Medicine Commercial Operations; Appoints Josh Forsythe as New VP of Marketing 3Tute Genomics Continues Expansion of Genomic Medicine Commercial Operations; Appoints Josh Forsythe as New VP of Marketing 4
... ... Position in Automated QT Studies , ... Rochester, New York (PRWEB) October 8, 2009 -- iCardiac Technologies, Inc., ... that an international pharmaceutical company has awarded iCardiac a comprehensive cardiac safety study. ...
... ... Obama , ... Ill. (Vocus) October 7, 2009 -- The IBM Blue Gene series of energy-efficient supercomputers, ... Barack Obama as a Medal of Technology and Innovation award-winner on October 7 in ...
... NEW YORK, Oct. 7 NeoStem, Inc. (NYSE Amex: ... processing and long-term storage of adult stem cells for ... Securities and Exchange Commission has declared effective its Registration ... The Registration Statement, including the joint proxy statement, is ...
Cached Biology Technology:Global Pharmaceutical Company Awards Comprehensive Cardiac Safety Study to iCardiac 2DOE Labs Take Pride in Award-Winning IBM Blue Gene Series 2DOE Labs Take Pride in Award-Winning IBM Blue Gene Series 3DOE Labs Take Pride in Award-Winning IBM Blue Gene Series 4United States Securities and Exchange Commission Declares Effective Registration Statement for NeoStem's Acquisition of China Biopharmaceuticals Holdings, Inc. and a Controlling Interest in Leading Chinese Pharmaceutical Company; Meeting of Each Com 2United States Securities and Exchange Commission Declares Effective Registration Statement for NeoStem's Acquisition of China Biopharmaceuticals Holdings, Inc. and a Controlling Interest in Leading Chinese Pharmaceutical Company; Meeting of Each Com 3United States Securities and Exchange Commission Declares Effective Registration Statement for NeoStem's Acquisition of China Biopharmaceuticals Holdings, Inc. and a Controlling Interest in Leading Chinese Pharmaceutical Company; Meeting of Each Com 4
(Date:4/14/2015)... Conn. , April 14, 2015 NXT-ID, ... a biometric authentication company focused on the growing mobile ... been nominated for the 2015 New York Design Awards ... The Design100, New York City Design Awards are part ... based on over 2,500 ratings from the marketplace, industry ...
(Date:4/10/2015)... 2015 Research and Markets ( ... "Security Competitive Profiles - NEC" report to their ... NEC will continue to supply a range of IT ... a company focus on the development of a Big ... opportunities in the Asia-Pacific region ...
(Date:4/6/2015)... , Apr. 6, 2015 NXT-ID, Inc. ... a biometric authentication company focused on the growing ... filed provisional patent 62/143028 for MINIATURE, ... ENERGY TRANSFER  NXT-ID introduces a new ... This patent surrounds the use of miniature antenna ...
Breaking Biology News(10 mins):NXT-ID's Wocket Smart Wallet Nominated for 2015 New York Design Awards in 'Product Design- Technology' 2NXT-ID's Wocket Smart Wallet Nominated for 2015 New York Design Awards in 'Product Design- Technology' 3NEC Security Competitive Profile 2015 2NXT-ID Patents Miniature, Low Power Wireless Magnetic Stripe 2NXT-ID Patents Miniature, Low Power Wireless Magnetic Stripe 3NXT-ID Patents Miniature, Low Power Wireless Magnetic Stripe 4
... to prevailing wisdom, a new study from plant biologists at ... indeed chaperone proteins across the membranes of chloroplasts, just as ... published online in the January issue of the journal ... tasks in a living cell is to move things across ...
... This release is available in Spanish . ... to ethnic minority groups receive worse health care in the ... world,s most developed countries. This conclusion emerges from a research ... most comprehensive bibliographic review worldwide to date on health care ...
... is impacted as much or more by environmental change ... Professor Caryn Vaughn, who serves as director of the ... extinct, we don,t necessarily think of the common species ... Vaughn. "We need to be concerned about these ...
Cached Biology News:Green plant transport mystery solved 2Poorer diabetics receive worse care than other in countries with universal health coverage 2Poorer diabetics receive worse care than other in countries with universal health coverage 3Environmental change impacts Oklahoma rivers 2
Bis-Acrylamide (bis) is a monomer used as a crosslinker with acrylamide to form polyacrylamide electrophoretic gels. This 2% bis solution is supplied as 500 ml....
... EnVision™ G|2 Doublestain System is a ... visualization kit. The kit is intended ... simultaneous detection of two different antigens ... compatible with suitably diluted rabbit and ...
AVOID FREEZE/THAW CYCLES. Recognizes the UCP-2 protein....
Rabbit Anti-Human Janus Kinase 2 (JAK2 Polyclonal Antibody Family: Protein Kinase Sub-Family: TYK2/JAK Applications: ELISA, Western Blot...
Biology Products: