Navigation Links
Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

corresponding unstained 10 m thick section using a micromanipulator (Narishige, Japan). For the aspiration of the lesions or morphologically normal cells capillaries of 1025 m diameter were used. The section was overlaid with TE, pH 8.0 (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). Aspiration only of the buffer served as contamination control. The aspirated cells/buffer were transferred to 5 l proteinase K digestion buffer (20 g proteinase K/ml in 10 mM Tris/HCl, 0.5% Nonidet P40) in PCR reaction vials. Digestion was performed for 10 minutes at 55 C to demask the DNA followed by an inactivation of the proteinase K (15 minutes at 96 C). To amplify the K-ras DNA PCR buffer was added to a final concentration of 12 mM Tris/HCl, pH 8.0, 50 mM KCl, 0.1% Nonidet, 0.2 mM each dNTP and 2 mM MgCl2. The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C, 40s 58 C, 30s 70 C). The final extension was 5 minutes at 70 C. PCR products were analyzed via a constant denaturing gel electrophoresis (CDGE) using the DCode universal mutation detection system (Bio-Rad, Germany). Gels contained 35% denaturant, 1x TAE, 7.5% polyacrylamide (30:1) and were run for 240 minutes at 200 V, 60 C and silver stained. For sequencing, the deviant bands were cut out of the gel and the DNA was eluted by soaking in TE. After reamplification and TA cloning (Invitrogen, The Netherlands) several clones were sequenced (ABI PRISM Dye Terminator Cycle Sequencing kit/


Page: All 1 2 3 4

Related biology technology :

1. Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins
2. A New PCR-based Mycoplasma Detection Method
3. HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
4. Detection and Identification of Phosphorylation Sites in Proteins Using LC/MS/MS with Neutral Fragment Loss Mapping
5. Detection of mRNAs on Cryosections of the Cardiovascular System Using DIG-Labeled RNA Probes
6. Gene Expression Arrays: Highly Sensitive Detection of Expression Patterns with Improved Tools for Target Amplification
7. The DIG System Nonradioactive and Highly Sensitive Detection of Nucleic Acids
8. Quantitative Measurement of Cell Proliferation Using the BrdU ELISA: A Comparison Between Colorimetric and Chemiluminescent Detection
9. Quantification of Nucleosomes in Serum by the Cell Death Detection ELISAplus
10. A Further Step in Understanding Apoptosis Direct Detection of PARP Cleavage
11. In Situ Cell Death Detection Kit
Post Your Comments:
(Date:8/1/2014)... Research and Markets has announced ... (SNP) Genotyping and Analysis Market 2014-2018" report to ... Single Nucleotide Polymorphism (SNP) genotyping is the ... the genome of various species. SNPs are commonly present ... technology can analyze thousands of SNPs and has the ...
(Date:8/1/2014)... Cambrex Corporation (NYSE: CBM ) reports results for ... Highlights , Second quarter sales increased 59% to ... year. , Second quarter EBITDA increased 86% to $21.2 ... year (see table at the end of this release). ... of foreign currency, to between 13% and 16% over 2013, ...
(Date:7/31/2014)... White City, CA (PRWEB) July 31, 2014 ... well as consumers, are increasingly searching for food ... functional and nutritional benefits. The food ingredient market ... small budding players such as Vital Force Technology ... maker with more than 4,000 energetic patterns, all ...
(Date:7/31/2014)... -- Nearly 20,000 medical professionals and healthcare leaders gathered ... Lab Expo in Chicago from ... research and technology that will advance medicine and get ... Wednesday, July 30, more than 19,500 attendees had registered ... Expo, with more than 10,000 of these attendees coming ...
Breaking Biology Technology:Global Single Nucleotide Polymorphism (SNP) Genotyping and Analysis Market 2014-2018 2Cambrex Reports Second Quarter 2014 Financial Results 2Cambrex Reports Second Quarter 2014 Financial Results 3Cambrex Reports Second Quarter 2014 Financial Results 4Cambrex Reports Second Quarter 2014 Financial Results 5Cambrex Reports Second Quarter 2014 Financial Results 6Cambrex Reports Second Quarter 2014 Financial Results 7Cambrex Reports Second Quarter 2014 Financial Results 8Cambrex Reports Second Quarter 2014 Financial Results 9Cambrex Reports Second Quarter 2014 Financial Results 10Cambrex Reports Second Quarter 2014 Financial Results 11Cambrex Reports Second Quarter 2014 Financial Results 12Cambrex Reports Second Quarter 2014 Financial Results 13Cambrex Reports Second Quarter 2014 Financial Results 14Cambrex Reports Second Quarter 2014 Financial Results 15Cambrex Reports Second Quarter 2014 Financial Results 16Functional Ingredient Manufacturer – Vital Force Technology Infuses Raw Materials & Ingredients with Subtle Energy Formula 2Research on Digital Health, Alzheimer's, Ebola Draws Nearly 20,000 Attendees to 2014 AACC Annual Meeting & Clinical Lab Expo 2Research on Digital Health, Alzheimer's, Ebola Draws Nearly 20,000 Attendees to 2014 AACC Annual Meeting & Clinical Lab Expo 3
... Nov. 21, 2011 WaferGen Biosystems, Inc. (OTCBB:WGBS), an ... the three and nine months ended September 30, 2011 ... adoption of its SmartChip System. "During the ... strategy to address the rapidly changing needs of the ...
... Phase I Single Dose Study Data ... Convergence Pharmaceuticals Limited ("Convergence"), the company focused ... medicines, today announces that the multiple ascending dose Phase ... channel blocker CNV2197944, for the treatment of chronic pain ...
... Japan, November 18, 2011 - A research group from ... and Fujitsu Limited today announced that research results obtained ... Bell Prize, Peak-Performance at SC11, the International Conference for ... in Seattle, on November 17 (US Pacific Standard Time). ...
Cached Biology Technology:WaferGen Reports Third Quarter 2011 Financial Results and Announces New Commercialization Strategy 2WaferGen Reports Third Quarter 2011 Financial Results and Announces New Commercialization Strategy 3WaferGen Reports Third Quarter 2011 Financial Results and Announces New Commercialization Strategy 4WaferGen Reports Third Quarter 2011 Financial Results and Announces New Commercialization Strategy 5WaferGen Reports Third Quarter 2011 Financial Results and Announces New Commercialization Strategy 6WaferGen Reports Third Quarter 2011 Financial Results and Announces New Commercialization Strategy 7WaferGen Reports Third Quarter 2011 Financial Results and Announces New Commercialization Strategy 8Convergence Pharmaceuticals Initiates Phase I Multiple Ascending Dose Study for CNV2197944 2Convergence Pharmaceuticals Initiates Phase I Multiple Ascending Dose Study for CNV2197944 3Convergence Pharmaceuticals Initiates Phase I Multiple Ascending Dose Study for CNV2197944 4'K computer' research results awarded ACM Gordon Bell Prize 2
(Date:8/1/2014)... Modern humans appear in the fossil record about 200,000 ... ago that making art and advanced tools became widespread. ... the journal Current Anthropology finds that human ... testosterone levels at around the same time that culture ... innovation, making art and rapid cultural exchange probably came ...
(Date:8/1/2014)... examining a taxonomically confused group of marine mammals ... the Australian humpback dolphin, Sousa sahulensis , ... Enterprises. , The study describing the newly ... long systematic examination of all available historical records, ... widespread group of coastal cetaceans ranging from the ...
(Date:8/1/2014)... key component of phloem, the conductive tissue through which ... molecules. Elongated cylindrical cells are capped at one end ... sieve tubes which in turn form a network throughout ... very special cells which play an important role in ... known about their differentiation," says Professor Yk Helariutta from ...
Breaking Biology News(10 mins):Society bloomed with gentler personalities and more feminine faces 2Scientists name new species of cetacean: The Australian humpback dolphin 2Scientists name new species of cetacean: The Australian humpback dolphin 3Developmental regulation of important plant phloem components discovered 2
... indicating that more than 50% of all osteoporotic hip fractures ... and treatment of osteoporotic fractures has become a major health ... Osteoporosis (IOF WCO), to be held for the first time ... the region to attend the leading global congress devoted to ...
... new drug trabectedin with pegylated liposomal doxorubicin provides clinical ... new results presented at the 33rd Congress of the ... The combination, which importantly does not include a ... women whose cancer recurs at least 6 months after ...
... N.C. A newly discovered chemical pathway that helps ... 20 common beta-blockers, drugs that are prescribed to millions ... Researchers from Duke University Medical Center tested 20 beta ... and carvedilol -- could stimulate a pathway recently found ...
Cached Biology News:IOF World Congress on Osteoporosis in Bangkok to address Asian issues 2Promising new treatment option for women with recurrent ovarian cancer 22 beta blockers found to also protect heart tissue 2
Coverslips for Microarrays, 1. *Category: MICROARRAY ACCESSORIES....
Agarase cleaves agarose to neoagaro-oligosaccharides, and is used for,quantitative, gentle recovery of DNA from low melting point agarose....
... plastic supports that retain stiffness in liquids, ... Paper segments on each strip have chemically ... indicator charts provide clear comparison. Full-range strips ... In packs of 100; each strip is ...
Biology Products: