Navigation Links
Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

corresponding unstained 10 m thick section using a micromanipulator (Narishige, Japan). For the aspiration of the lesions or morphologically normal cells capillaries of 1025 m diameter were used. The section was overlaid with TE, pH 8.0 (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). Aspiration only of the buffer served as contamination control. The aspirated cells/buffer were transferred to 5 l proteinase K digestion buffer (20 g proteinase K/ml in 10 mM Tris/HCl, 0.5% Nonidet P40) in PCR reaction vials. Digestion was performed for 10 minutes at 55 C to demask the DNA followed by an inactivation of the proteinase K (15 minutes at 96 C). To amplify the K-ras DNA PCR buffer was added to a final concentration of 12 mM Tris/HCl, pH 8.0, 50 mM KCl, 0.1% Nonidet, 0.2 mM each dNTP and 2 mM MgCl2. The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C, 40s 58 C, 30s 70 C). The final extension was 5 minutes at 70 C. PCR products were analyzed via a constant denaturing gel electrophoresis (CDGE) using the DCode universal mutation detection system (Bio-Rad, Germany). Gels contained 35% denaturant, 1x TAE, 7.5% polyacrylamide (30:1) and were run for 240 minutes at 200 V, 60 C and silver stained. For sequencing, the deviant bands were cut out of the gel and the DNA was eluted by soaking in TE. After reamplification and TA cloning (Invitrogen, The Netherlands) several clones were sequenced (ABI PRISM Dye Terminator Cycle Sequencing kit/
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins
2. A New PCR-based Mycoplasma Detection Method
3. HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
4. Detection and Identification of Phosphorylation Sites in Proteins Using LC/MS/MS with Neutral Fragment Loss Mapping
5. Detection of mRNAs on Cryosections of the Cardiovascular System Using DIG-Labeled RNA Probes
6. Gene Expression Arrays: Highly Sensitive Detection of Expression Patterns with Improved Tools for Target Amplification
7. The DIG System Nonradioactive and Highly Sensitive Detection of Nucleic Acids
8. Quantitative Measurement of Cell Proliferation Using the BrdU ELISA: A Comparison Between Colorimetric and Chemiluminescent Detection
9. Quantification of Nucleosomes in Serum by the Cell Death Detection ELISAplus
10. A Further Step in Understanding Apoptosis Direct Detection of PARP Cleavage
11. In Situ Cell Death Detection Kit
Post Your Comments:
(Date:1/22/2015)... (PRWEB) January 22, 2015 Controlled Substance ... Alliance, which helps companies check the legal requirements around ... expand to China. , As their international operations ... globally adopting software solutions built as a result of ...
(Date:1/22/2015)... Nueva Jersey , 22 de enero de 2015  El ... abre hoy su llamada a nominaciones para 2015. Este ... ha hecho, o tiene el potencial para hacer, contribuciones ... nominaciones se aceptarán hasta el 15 de marzo de ...
(Date:1/22/2015)... GenoSpace , a precision medicine software company that has developed ... of genomic, imaging and other biomedical data in research and ... , CEO of Aspera, an IBM Company, to its board ... "We are pleased to welcome Michelle ...
(Date:12/24/2014)...  United Therapeutics Corporation (NASDAQ: UTHR ) announced ... has submitted a pre-market approval application to the U.S. ... Medtronic,s SynchroMed ® II implantable drug infusion system ... Therapeutics, Remodulin ® (treprostinil) Injection delivered intravenously to ...
Breaking Biology Technology:Global Compliance Service for Controlled Substances to Expand to China 2El Dr. Paul Janssen Award for Biomedical Research emite su llamada a los nominados para 2015 2El Dr. Paul Janssen Award for Biomedical Research emite su llamada a los nominados para 2015 3El Dr. Paul Janssen Award for Biomedical Research emite su llamada a los nominados para 2015 4GenoSpace Expands Board with Appointment of Michelle Munson 2United Therapeutics Announces Submission Of Pre-Market Approval Application For Implantable Drug Infusion System To Deliver Remodulin 2United Therapeutics Announces Submission Of Pre-Market Approval Application For Implantable Drug Infusion System To Deliver Remodulin 3United Therapeutics Announces Submission Of Pre-Market Approval Application For Implantable Drug Infusion System To Deliver Remodulin 4
... Life Sciences,Holdings, Inc. (Nasdaq: ADLS ), a ... of novel drugs in the,therapeutic areas of infection, ... for the third quarter ended September 30,2008., ... available to common shareholders for the three months,ended ...
... (Nasdaq: PRXL ), a leading global biopharmaceutical ... the first to conduct a,Chinese bridging study outside ... bridging studies, which are conducted in early clinical ... gather,relevant ethnic data in the U.S., and save ...
... US In ... Locations Other Than Switzerland, BETHESDA, Md., Nov. 6 ... NWBT), today,announced that it has obtained US$1.65 million in funding ... Capital Group SPC,Ltd ("SDS") and a group of private investors ...
Cached Biology Technology:Advanced Life Sciences Announces Third Quarter 2008 Financial Results 2Advanced Life Sciences Announces Third Quarter 2008 Financial Results 3Advanced Life Sciences Announces Third Quarter 2008 Financial Results 4Advanced Life Sciences Announces Third Quarter 2008 Financial Results 5Advanced Life Sciences Announces Third Quarter 2008 Financial Results 6Advanced Life Sciences Announces Third Quarter 2008 Financial Results 7Advanced Life Sciences Announces Third Quarter 2008 Financial Results 8Advanced Life Sciences Announces Third Quarter 2008 Financial Results 9Advanced Life Sciences Announces Third Quarter 2008 Financial Results 10Advanced Life Sciences Announces Third Quarter 2008 Financial Results 11PAREXEL Expands Pioneering Asian Ethnobridging Expertise 2PAREXEL Expands Pioneering Asian Ethnobridging Expertise 3PAREXEL Expands Pioneering Asian Ethnobridging Expertise 4PAREXEL Expands Pioneering Asian Ethnobridging Expertise 5Northwest Secures US$1.65 Million Debt Financing 2Northwest Secures US$1.65 Million Debt Financing 3Northwest Secures US$1.65 Million Debt Financing 4
(Date:1/22/2015)... , Jan. 20, 2015 NXT-ID, Inc. (NASDAQ: NXTD ... commerce market, reports on the recent success of the Wocket™ smart wallet ... Wocket smart wallet was named as one of the "11 Hot ... "5 Best Products Launched At CES So Far" by Newseveryday.com and "The ...
(Date:1/22/2015)... Jan. 22, 2015   EyeLock, Inc. , a market leader ... Steve Gerber to the new role of Senior ... for leading development of mobile platforms and wearable solutions for ... and innovation in the semiconductor industry to his role at ...
(Date:12/22/2014)... 22, 2014  The 2014 Holiday Season may be the ... Intelligence reports that the long anticipated floodgates for consumer ... demand for smart phones, tablets, and wearable mobile devices ... 2.5 billion users with nearly 4.8 billion biometric devices ...
Breaking Biology News(10 mins):CES Response for NXT-ID's Wocket Smart Wallet Kicks Off 2015 2CES Response for NXT-ID's Wocket Smart Wallet Kicks Off 2015 3EyeLock Names Steve Gerber as Senior Vice President of Mobile and Wearables 2First Season of Holiday Shopping with Mobile Biometric Payments Wraps Up With a Present for Biometrics Industry: A Rosy Forecast for More Than 2 Billion Users of 4.8 Billion Mobile Biometric Devices by 2020 2
... a calcium carbonate crystal, a simple mollusk may have evolved ... Speiser, a postdoctoral fellow in the Department of Ecology Evolution ... he collected in the Florida Keys. His research of their ... in a study published today by Current Biology . ...
... of couples struggling with infertility is on the rise, and ... fertilization (IVF), to get pregnant. Although IVF can be ... (i.e., twins or triplets), which are often caused by transferring ... to be born prematurely, and, as a result, many have ...
... DALLAS April 14, 2011 A natural hormone ... fibrosis, UT Southwestern Medical Center researchers have demonstrated. Scientists ... in mice that the anti-aging hormone Klotho suppressed both renal ... and the spread of cancer. The findings are available online ...
Cached Biology News:Eyes of rock let chitons see predators 2New study finds stronger regulations of in vitro fertilization may save lives 2Anti-aging hormone Klotho inhibits renal fibrosis, cancer growth 2
Anti-Wnt-2 Polyclonal Antibody Description: 100 g purified goat polyclonal antibody. Reacts with human/mouse/rat. Tested in Western blot/IP/IHC. Research Focus: signal transduction Storage...
...
Mynox is intended for research use only. Mynox is used for the elimination of Mycoplasma and Acholeplasma in cell and virus cultures, and other biologicals....
... Acridinium NHS ester can ... and nucleic acids. The covalently ... produce chemiluminescence in the presence ... ester-labeled proteins can be used ...
Biology Products: