Navigation Links
Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

corresponding unstained 10 m thick section using a micromanipulator (Narishige, Japan). For the aspiration of the lesions or morphologically normal cells capillaries of 1025 m diameter were used. The section was overlaid with TE, pH 8.0 (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). Aspiration only of the buffer served as contamination control. The aspirated cells/buffer were transferred to 5 l proteinase K digestion buffer (20 g proteinase K/ml in 10 mM Tris/HCl, 0.5% Nonidet P40) in PCR reaction vials. Digestion was performed for 10 minutes at 55 C to demask the DNA followed by an inactivation of the proteinase K (15 minutes at 96 C). To amplify the K-ras DNA PCR buffer was added to a final concentration of 12 mM Tris/HCl, pH 8.0, 50 mM KCl, 0.1% Nonidet, 0.2 mM each dNTP and 2 mM MgCl2. The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C, 40s 58 C, 30s 70 C). The final extension was 5 minutes at 70 C. PCR products were analyzed via a constant denaturing gel electrophoresis (CDGE) using the DCode universal mutation detection system (Bio-Rad, Germany). Gels contained 35% denaturant, 1x TAE, 7.5% polyacrylamide (30:1) and were run for 240 minutes at 200 V, 60 C and silver stained. For sequencing, the deviant bands were cut out of the gel and the DNA was eluted by soaking in TE. After reamplification and TA cloning (Invitrogen, The Netherlands) several clones were sequenced (ABI PRISM Dye Terminator Cycle Sequencing kit/
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins
2. A New PCR-based Mycoplasma Detection Method
3. HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
4. Detection and Identification of Phosphorylation Sites in Proteins Using LC/MS/MS with Neutral Fragment Loss Mapping
5. Detection of mRNAs on Cryosections of the Cardiovascular System Using DIG-Labeled RNA Probes
6. Gene Expression Arrays: Highly Sensitive Detection of Expression Patterns with Improved Tools for Target Amplification
7. The DIG System Nonradioactive and Highly Sensitive Detection of Nucleic Acids
8. Quantitative Measurement of Cell Proliferation Using the BrdU ELISA: A Comparison Between Colorimetric and Chemiluminescent Detection
9. Quantification of Nucleosomes in Serum by the Cell Death Detection ELISAplus
10. A Further Step in Understanding Apoptosis Direct Detection of PARP Cleavage
11. In Situ Cell Death Detection Kit
Post Your Comments:
(Date:7/29/2015)... (Q2 2015: +14% CER / 20% of sales) led the regional performance ... , as well as solid contributions from Korea, India ... Middle East / Africa (Q2 ... , Turkey and the United Kingdom ... 11%, excluding U.S. HPV sales, on demand across all customer classes. The top ...
(Date:7/29/2015)... July 29, 2015  HealthSouth Corporation ... largest providers of post-acute healthcare services, offering both ... results of operations for the second quarter ended ... was characterized by strong volume growth in both ... EBITDA," said Jay Grinney, President and Chief Executive ...
(Date:7/29/2015)... ... July 29, 2015 , ... ... supplier, announces the launch of their 2nd generation cell therapy POD® design. The ... CT, but it also represents a new POD® design. , “G-CON first ...
(Date:7/29/2015)... ... July 29, 2015 , ... Brady ... GHS Label Guide . To align chemical container labeling with OSHA’s updated ... explanations of label components, an example of an accurate label, and pictogram uses ...
Breaking Biology Technology:QIAGEN Reports Results for Second Quarter and First Half of 2015 2QIAGEN Reports Results for Second Quarter and First Half of 2015 3QIAGEN Reports Results for Second Quarter and First Half of 2015 4QIAGEN Reports Results for Second Quarter and First Half of 2015 5QIAGEN Reports Results for Second Quarter and First Half of 2015 6QIAGEN Reports Results for Second Quarter and First Half of 2015 7QIAGEN Reports Results for Second Quarter and First Half of 2015 8QIAGEN Reports Results for Second Quarter and First Half of 2015 9QIAGEN Reports Results for Second Quarter and First Half of 2015 10HealthSouth Reports Results for Second Quarter 2015 2HealthSouth Reports Results for Second Quarter 2015 3HealthSouth Reports Results for Second Quarter 2015 4HealthSouth Reports Results for Second Quarter 2015 5HealthSouth Reports Results for Second Quarter 2015 6HealthSouth Reports Results for Second Quarter 2015 7HealthSouth Reports Results for Second Quarter 2015 8HealthSouth Reports Results for Second Quarter 2015 9HealthSouth Reports Results for Second Quarter 2015 10HealthSouth Reports Results for Second Quarter 2015 11HealthSouth Reports Results for Second Quarter 2015 12HealthSouth Reports Results for Second Quarter 2015 13HealthSouth Reports Results for Second Quarter 2015 14HealthSouth Reports Results for Second Quarter 2015 15HealthSouth Reports Results for Second Quarter 2015 16HealthSouth Reports Results for Second Quarter 2015 17HealthSouth Reports Results for Second Quarter 2015 18HealthSouth Reports Results for Second Quarter 2015 19HealthSouth Reports Results for Second Quarter 2015 20HealthSouth Reports Results for Second Quarter 2015 21HealthSouth Reports Results for Second Quarter 2015 22HealthSouth Reports Results for Second Quarter 2015 23HealthSouth Reports Results for Second Quarter 2015 24HealthSouth Reports Results for Second Quarter 2015 25HealthSouth Reports Results for Second Quarter 2015 26HealthSouth Reports Results for Second Quarter 2015 27
... 2010 Savara Inc., an inhalation product development company, ... its Board of Directors. In 1983 Mr. ... he guided the growth of that organization to over ... the largest clinical contract research organizations in the world. ...
... Nov. 8, 2010 Transgenomic, Inc. (OTC ... of a development study of several new assays to ... Lower Denaturing Temperature PCR (COLD-PCR) technology in the Epidermal ... in a number of cancers, including lung and colorectal ...
... TPC Group Inc. (Nasdaq: TPCG ) today announced ... repurchase for cash shares of its common stock at a purchase ... share. The Company will purchase shares having an aggregate purchase price ... the tender offer, Company stockholders may tender all or a portion ...
Cached Biology Technology:Savara Announces Appointment of Pharmaceutical Veteran to Board of Directors 2Transgenomic Develops New Assays to Detect EGFR Mutations Using COLD-PCR 2Transgenomic Develops New Assays to Detect EGFR Mutations Using COLD-PCR 3Transgenomic Develops New Assays to Detect EGFR Mutations Using COLD-PCR 4TPC Group Announces Commencement of Dutch Auction Tender Offer to Repurchase for Cash up to $130 Million in Common Stock 2TPC Group Announces Commencement of Dutch Auction Tender Offer to Repurchase for Cash up to $130 Million in Common Stock 3TPC Group Announces Commencement of Dutch Auction Tender Offer to Repurchase for Cash up to $130 Million in Common Stock 4
(Date:6/30/2015)... 2015 To bolster its efforts and commitment to ... today the addition of two new team members. ... and David Raviv will act as head of ... commitment to providing the most secure solutions for the enterprise ... Layer 7 Technologies, a provider of security and management products, ...
(Date:6/26/2015)... -- ATL Technology, LLC, a top provider of electromechanical contract ... solutions, headquartered in Springville, Utah , has ... corporation with locations in Santa Clara, ... ). This acquisition will incorporate MedConx,s manufacturing ... Technology,s existing facility in Costa Rica , ...
(Date:6/25/2015)... PRINCETON, N.J. , June 25, 2015  TAKE ... awarded a patent by the United States Patent and ... Data Standardization". This process leverages TAKE Solutions, Clinical Accelerators ... by over 50% (when compared to standardization without the ... At the heart ...
Breaking Biology News(10 mins):HYPR Corp. Expands Biometric Authentication Team with Enterprise All Stars 2HYPR Corp. Expands Biometric Authentication Team with Enterprise All Stars 3ATL Technology Announces Acquisition of MedConx, Inc. and Expanded Global Footprint 2TAKE Solutions Awarded Patent By USPTO 2
... study released online on July 22 in the journal ... researchers at Arizona State University and Princeton University show ... our multimodal, egg-headed, tool-using, bipedal, opposing-thumbed selves. ... "stupider" than ants. Humans and animals simply often make ...
... Researchers at the University of Texas Medical Branch at Galveston ... using depot medroxyprogesterone acetate, more commonly known as Depo-Provera or ... all women who use DMPA will gain weight and will ... weight increased by 5 percent within the first six months ...
... training your brain may be just as effective as training ... a shift from performance-based to prevention-based athletic training programs. ... the four major ligaments of the knee, and ACL injuries ... economic strain on the medical system. University of ...
Cached Biology News:Ants more rational than humans 2UTMB study identifies women at risk of gaining excessive weight with injectable birth control 2Knee injuries may start with strain on the brain, not the muscles 2
Mouse P-Selectin/CD62P MAb (Clone 127933)...
IgD Chain C (AMS 9.1)...
Bethyl Laboratories packages antibodies, conjugates and calibrators to provide quantitative ELISA kits. Each kit contains the following components, sufficient for 1000 single well assays....
quantitation of phosphatase activity, evaluation of hits and leads from HTS...
Biology Products: