Navigation Links
Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

corresponding unstained 10 m thick section using a micromanipulator (Narishige, Japan). For the aspiration of the lesions or morphologically normal cells capillaries of 1025 m diameter were used. The section was overlaid with TE, pH 8.0 (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). Aspiration only of the buffer served as contamination control. The aspirated cells/buffer were transferred to 5 l proteinase K digestion buffer (20 g proteinase K/ml in 10 mM Tris/HCl, 0.5% Nonidet P40) in PCR reaction vials. Digestion was performed for 10 minutes at 55 C to demask the DNA followed by an inactivation of the proteinase K (15 minutes at 96 C). To amplify the K-ras DNA PCR buffer was added to a final concentration of 12 mM Tris/HCl, pH 8.0, 50 mM KCl, 0.1% Nonidet, 0.2 mM each dNTP and 2 mM MgCl2. The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C, 40s 58 C, 30s 70 C). The final extension was 5 minutes at 70 C. PCR products were analyzed via a constant denaturing gel electrophoresis (CDGE) using the DCode universal mutation detection system (Bio-Rad, Germany). Gels contained 35% denaturant, 1x TAE, 7.5% polyacrylamide (30:1) and were run for 240 minutes at 200 V, 60 C and silver stained. For sequencing, the deviant bands were cut out of the gel and the DNA was eluted by soaking in TE. After reamplification and TA cloning (Invitrogen, The Netherlands) several clones were sequenced (ABI PRISM Dye Terminator Cycle Sequencing kit/
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins
2. A New PCR-based Mycoplasma Detection Method
3. HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
4. Detection and Identification of Phosphorylation Sites in Proteins Using LC/MS/MS with Neutral Fragment Loss Mapping
5. Detection of mRNAs on Cryosections of the Cardiovascular System Using DIG-Labeled RNA Probes
6. Gene Expression Arrays: Highly Sensitive Detection of Expression Patterns with Improved Tools for Target Amplification
7. The DIG System Nonradioactive and Highly Sensitive Detection of Nucleic Acids
8. Quantitative Measurement of Cell Proliferation Using the BrdU ELISA: A Comparison Between Colorimetric and Chemiluminescent Detection
9. Quantification of Nucleosomes in Serum by the Cell Death Detection ELISAplus
10. A Further Step in Understanding Apoptosis Direct Detection of PARP Cleavage
11. In Situ Cell Death Detection Kit
Post Your Comments:
(Date:7/10/2014)... 2014 Deep Knowledge Ventures last ... on ‘Commercialising Longevity Research’ and welcomed a host ... London Bioscience Innovation Center for the event, organised ... Analytics Ltd. The meeting highlighted the need for ... for age-related disease, as well as the crucial ...
(Date:7/10/2014)... OMICS Group’s 5th International conference and ... 2014 at Double Tree by Hilton Beijing, China is ... Analytical & Bioanalytical research methods only to facilitate improved ... occasion, Dr. Srinubabu Gedela, MD of OMICS Group Inc ... remarkable one in bringing a unique and international mix ...
(Date:7/10/2014)... Capital, a firm specializing in acquiring and managing food ... the Slim-Fast brand from Unilever. Unilever will retain a ... were not disclosed. Slim-Fast is a branded ... shakes, powders, bars and snacks to retail customers throughout ... United Kingdom and Ireland.  The ...
(Date:7/10/2014)... help in the fight against terrorism with the creation ... explosives with the use of light and special glass ... Actuators B: Chemical , the researchers describe a novel ... as low as 6.3 ppm (parts per million). It ... , "Traditionally explosives detection has involved looking for metals ...
Breaking Biology Technology:DKV Sponsors Forum on Commercialising Longevity Research; Brings Together Scientists, Investors, Entrepreneurs and Celebrities 2DKV Sponsors Forum on Commercialising Longevity Research; Brings Together Scientists, Investors, Entrepreneurs and Celebrities 3DKV Sponsors Forum on Commercialising Longevity Research; Brings Together Scientists, Investors, Entrepreneurs and Celebrities 4DKV Sponsors Forum on Commercialising Longevity Research; Brings Together Scientists, Investors, Entrepreneurs and Celebrities 5DKV Sponsors Forum on Commercialising Longevity Research; Brings Together Scientists, Investors, Entrepreneurs and Celebrities 6A Critical Review of Analytical Techniques for Improved Living Standards 2A Critical Review of Analytical Techniques for Improved Living Standards 3A Critical Review of Analytical Techniques for Improved Living Standards 4Kainos Capital Acquires Slim-Fast From Unilever 2Detecting trace amounts of explosives with light 2
... Corp. said it has bought all outstanding stock ... handles bank transactions and check image processing. , ,Metavante, ... said in October that it would buy VectorSGIs stock ... wholly owned subsidiary. The move followed Metavantes acquisition of ...
... Jim Doyle, right, is joined by Commerce Sec. Cory ... Wis. Wisconsins Department of Commerce will fund ... and other assistance at centers around the state, Governor ... provide $1 million per year for five years, he ...
... U.S. Supreme Court made a patent-law decision on Monday that ... sector. , ,The court denied an appeal in Univ. ... solidifies the decision that was made by the U.S. Court ... patent because the inventor did not provide an adequate written ...
Cached Biology Technology:State and university form network for entrepreneurial outreach 2State and university form network for entrepreneurial outreach 3Describe your invention, or your biotech patent may be worthless 2Describe your invention, or your biotech patent may be worthless 3Describe your invention, or your biotech patent may be worthless 4Describe your invention, or your biotech patent may be worthless 5
(Date:7/11/2014)... under the normal circumstances, astrocytes participate in ... environment, and exhibit therapeutic and repairing effects ... studies have found that nerve cells differentiated ... have reduced viability, which produces influences on ... Kailuan General Hospital, Hebei United University, China ...
(Date:7/11/2014)... July 11, 2014 Research and Markets ... Biometrics Technology Market - Industry Analysis Size Share Growth ... offering. http://photos.prnewswire.com/prnh/20130307/600769 ... has created a need for high level security in ... personnel authentication such as username and passwords, tokens etc. ...
(Date:7/11/2014)... Rio de Janeiro, Brazil- In the brains of ... mechanism that allows an electric or chemical signal ... another. Chemical synapses, which are the most abundant ... inhibitory. Synapse formation is crucial for learning, memory, ... and inhibitory synapses critical for brain function. ...
Breaking Biology News(10 mins):International Biometrics Technology Market - Industry Analysis Size Share Growth Trends and Forecast to 2019 2Blame it on the astrocytes 2
... number one killer in the world and India carries more ... set to rise: it is predicted that by 2010 India,s ... Today, an international team of 25 scientists from four countries ... the world,s population carries a mutation almost guaranteed to lead ...
... of yeast cells has resulted in the most detailed ... a Texas A&M University chemical engineering professor whose findings ... until now have remained mostly theory., Working with populations ... Katy Kao, assistant professor in the Artie McFerrin Department ...
... new, international competition called the Digging into Data ... the Joint Information Systems Committee (JISC) from the ... (NEH) and the National Science Foundation (NSF) from ... Humanities Research Council (SSHRC) from Canada. ...
Cached Biology News:The heart disease mutation carried by 60 million 2Evolutionary process more detailed than previously believed, study shows 2Evolutionary process more detailed than previously believed, study shows 3Evolutionary process more detailed than previously believed, study shows 4Leading research agencies announce new international competition: "The digging into data challenge" 2
... water bath, with a comprehensive array of ... water baths with seamless, splash-water protected keypad ... MULTI-DISPLAY (LED) indicating up to 6 temperature ... Advanced MICROPROCESSOR technology with PID temperature control ...
Request Info...
... an aqueous solution that contains a purified ... in a MOPS buffer (3-(N-Morpholino) propanesulfonic acid), ... contains a combination of 0.02% methylisothiazolone, 0.02% ... and Haas Company) as a preservative. ...
Preparation Note: by a modification of the procedure of C.W. Hancher et al., Biotechnol. Bioeng. 11, 1055 (1969) Assay: ~ 20 A 260 /mg Solubility: water 10 mg/mL, clear, light-yellow Suitab tst...
Biology Products: