Navigation Links
Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

Martin A.O.H. Menke*, Axel Reinecke-Lthge*, Barbara Mllmann*, Angela Kellner, Jutta Lttges*, Gnter Klppel*
* Department of Pathology and Department of Hematopathology, Christian- Albrechts University Kiel, Michaelisstrae 11, D-24105 Kiel, Germany.


Introduction

Genetic alterations/variations are the cause underlying many non-neoplastic and probably all neoplastic diseases. Today the number of reports associating genetic alterations with cancer1 and other diseases is rapidly increasing. In many cases the exchange of only one or a few bases, so called point mutations, give rise to severe disease.

We are specifically interested in ductal adenocarcinoma of the exocrine pancreas, which is the second most frequent cause of death by digestive tract cancer.2 Nearly all of these tumors bear a point mutation in codon 12 of the K-ras protooncogene.3, 4 We wanted to determine the frequency of these mutations in ductal lesions and associated tissues of tumor free pancreases. We used microdissection followed by a sensitive single step PCR regime to amplify the exon 1 of the K-ras gene. Point mutations were detected by constant denaturing gel electrophoresis (CDGE)5 using the DCode universal mutation detection system.


Materials and Methods

Archived, formalin-fixed, paraffin-embedded pancreas tissue samples of patients without pancreatic ductal adenocarcinoma were drawn from the files of the Institute of Pathology. Evaluation of conservation was done by histological routine procedures. A section was stained with Hematoxylin & Eosin and used as reference. Cells were microdissected from an immediate corresponding unstained 10 m thick section using a micromanipulator (Narishige, Japan). For the aspiration of the lesions or morphologically normal cells capillaries of 1025 m diameter were used. The section was overlaid with TE, pH 8.0 (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). Aspiration only of the buffer served as contamination control. The aspirated cells/buffer were transferred to 5 l proteinase K digestion buffer (20 g proteinase K/ml in 10 mM Tris/HCl, 0.5% Nonidet P40) in PCR reaction vials. Digestion was performed for 10 minutes at 55 C to demask the DNA followed by an inactivation of the proteinase K (15 minutes at 96 C). To amplify the K-ras DNA PCR buffer was added to a final concentration of 12 mM Tris/HCl, pH 8.0, 50 mM KCl, 0.1% Nonidet, 0.2 mM each dNTP and 2 mM MgCl2. The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C, 40s 58 C, 30s 70 C). The final extension was 5 minutes at 70 C. PCR products were analyzed via a constant denaturing gel electrophoresis (CDGE) using the DCode universal mutation detection system (Bio-Rad, Germany). Gels contained 35% denaturant, 1x TAE, 7.5% polyacrylamide (30:1) and were run for 240 minutes at 200 V, 60 C and silver stained. For sequencing, the deviant bands were cut out of the gel and the DNA was eluted by soaking in TE. After reamplification and TA cloning (Invitrogen, The Netherlands) several clones were sequenced (ABI PRISM Dye Terminator Cycle Sequencing kit/ ABI PRISM 310 automated sequencer, Applied Biosystems, Germany).


Results

The calculated melting profile of the generated PCR fragment shows that it contains three melting domains. The putative mutations were in the second melting domain, which could not be analyzed without a GC clamp (the most stable domain) (Figure 1). The difference in melting profiles of the mutant and wt K-ras PCR-products should allow separation via CDGE (Figure 2). As controls we generated mutated sequences by PCR and cloning. Figure 3 shows a 2050% denaturant perpendicular DGGE gel run to determine the optimal denaturant concentration for the CDGE analysis, which was determined to be 35% (Figure 3). A 35% CDGE gel was run with samples from all mutations of codon 12 leading to an amino acid exchange and wt PCR products (Figure 4).

We analyzed 1,069 samples of 71 pancreases. Mutations were detected in 16 samples of 12 pancreases. With the exception of 2 samples of normal duct cells (243 screened) all the mutation-positive samples were from lesions (605 screened). All acinar cells screened (221) were negative. Figure 5 shows a typical result with one of the positive samples. In contrast to this low frequency, we could detect K-ras point mutations in more than 95% of ductal adenocarcinoma of the pancreas (data not shown).


Discussion

Mutations of K-ras were thought to be quite rare in pancreases free of ductal adenocarcinoma. However, we detected mutations in 16 samples from normal pancreases. This finding raises the question which role K-ras mutations play in the series of genetic alterations leading to ductal adenocarcinoma of the pancreas. We believe it is a very early genetic change promoting cancer but not causing it. As K-ras mutations can be found in morphologically normal cells and in tumor free pancreases, caution should be used when interpreting findings of mutations in pancreatic juice [e.g. 6] or faeces.


References

1. Williams, J. R., Russel, J., Dicello, J. F., and Mabry, M. H., The genotype of the human cancer cell: implication for risk analysis, Mutat Res., 365, 1742, (1996).

2. Parker, S. L., Tong, T., Bolden, S., and Wingo, P. A., Cancer statistics, 1996, CA, Cancer J Clin 46, 527, (1996).

3. Chu, T. M., Molecular diagnosis of pancreas carcinoma, J. Clin. Lab. Anal. 11, 225231 (1997).

4. Klppel G., Gene Changes and Pancreatic Carcinoma: The Significance of K-ras, Dig. Surg., 11, 164169 (1994).

5. Brresen, A. L., Hovig, E., Smith-Sorensen, B., Malkin, D., Lystad, S., Andersen, T., Nesland, J., Isselbacher, K. J. and Friend, S., Constant denaturant gel electrophoresis as a rapid screening techique for p53 mutation, Proc. Natl. Acad. Sci., 88, 84058409 (1991).

6. Kondo, H., Sugano, K., Fukayama, N., Hosokawa, K., Ohkura, H., Ohtsu, A., Mukai, K., and Yoshida, S., Detection of K-ras gen mutations at codon 12 in the pancreatic juice of patients with intraductal papillary mucinous tumors of the pancreas, Cancer, 79, 900905 (1997).


back to top
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins
2. A New PCR-based Mycoplasma Detection Method
3. HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
4. Detection and Identification of Phosphorylation Sites in Proteins Using LC/MS/MS with Neutral Fragment Loss Mapping
5. Detection of mRNAs on Cryosections of the Cardiovascular System Using DIG-Labeled RNA Probes
6. Gene Expression Arrays: Highly Sensitive Detection of Expression Patterns with Improved Tools for Target Amplification
7. The DIG System Nonradioactive and Highly Sensitive Detection of Nucleic Acids
8. Quantitative Measurement of Cell Proliferation Using the BrdU ELISA: A Comparison Between Colorimetric and Chemiluminescent Detection
9. Quantification of Nucleosomes in Serum by the Cell Death Detection ELISAplus
10. A Further Step in Understanding Apoptosis Direct Detection of PARP Cleavage
11. In Situ Cell Death Detection Kit
Post Your Comments:
*Name:
*Comment:
*Email:


(Date:5/25/2016)... Phoenix, AZ (PRWEB) , ... May 25, 2016 ... ... Arizona, Dr. Michael Fitzmaurice recently became double board-certified in surgery and surgery of ... 31, 2015. Dr. Fitzmaurice is no stranger to going above and beyond in ...
(Date:5/25/2016)... ... May 25, 2016 , ... Scientists at the University of Athens say ... mesothelioma may be hampering the research that could lead to one good one. Surviving ... read it now. , The team evaluated 98 mesothelioma patients who ...
(Date:5/25/2016)... ... 2016 , ... Lady had been battling arthritis since the age of two ... knee. Lady’s owner Hannah sought the help of Dr Jeff Christiansen of Superior ... cruciate ligament and help with the pain of Lady’s arthritis. Dr Christiansen suggested that ...
(Date:5/24/2016)... , ... May 24, 2016 , ... ... diabetes, and traumatic injuries, will be accelerated by research at Worcester Polytechnic Institute ... engines of wound healing and tissue regeneration. , The novel method, developed by ...
Breaking Biology Technology:
(Date:3/31/2016)... , March 31, 2016  Genomics firm Nabsys has ... CEO, Barrett Bready , M.D., who returned to ... the original technical leadership team, including Chief Technology Officer, ... Product Development, Steve Nurnberg and Vice President of Software ... the company. Dr. Bready served as CEO ...
(Date:3/21/2016)... Unique technology combines v ... security   Xura, Inc. ... digital communications services, today announced it is working alongside ... customers, particularly those in the Financial Services Sector, the ... within a mobile app, alongside, and in combination with, ...
(Date:3/14/2016)... NXTD ) ("NXT-ID" or the "Company"), a company ... of a new series of commercials on Time Warner Cable ... .  The commercials will air on Bloomberg TV, Fox Business ... show. --> NXTD ) ("NXT-ID" or the "Company"), ... the airing of a new series of commercials on Time ...
Breaking Biology News(10 mins):