Navigation Links
Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

Martin A.O.H. Menke*, Axel Reinecke-Lthge*, Barbara Mllmann*, Angela Kellner, Jutta Lttges*, Gnter Klppel*
* Department of Pathology and Department of Hematopathology, Christian- Albrechts University Kiel, Michaelisstrae 11, D-24105 Kiel, Germany.


Genetic alterations/variations are the cause underlying many non-neoplastic and probably all neoplastic diseases. Today the number of reports associating genetic alterations with cancer1 and other diseases is rapidly increasing. In many cases the exchange of only one or a few bases, so called point mutations, give rise to severe disease.

We are specifically interested in ductal adenocarcinoma of the exocrine pancreas, which is the second most frequent cause of death by digestive tract cancer.2 Nearly all of these tumors bear a point mutation in codon 12 of the K-ras protooncogene.3, 4 We wanted to determine the frequency of these mutations in ductal lesions and associated tissues of tumor free pancreases. We used microdissection followed by a sensitive single step PCR regime to amplify the exon 1 of the K-ras gene. Point mutations were detected by constant denaturing gel electrophoresis (CDGE)5 using the DCode universal mutation detection system.

Materials and Methods

Archived, formalin-fixed, paraffin-embedded pancreas tissue samples of patients without pancreatic ductal adenocarcinoma were drawn from the files of the Institute of Pathology. Evaluation of conservation was done by histological routine procedures. A section was stained with Hematoxylin & Eosin and used as reference. Cells were microdissected from an immediate corresponding unstained 10 m thick section using a micromanipulator (Narishige, Japan). For the aspiration of the lesions or morphologically normal cells capillaries of 1025 m diameter were used. The section was overlaid with TE, pH 8.0 (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). Aspiration only of the buffer served as contamination control. The aspirated cells/buffer were transferred to 5 l proteinase K digestion buffer (20 g proteinase K/ml in 10 mM Tris/HCl, 0.5% Nonidet P40) in PCR reaction vials. Digestion was performed for 10 minutes at 55 C to demask the DNA followed by an inactivation of the proteinase K (15 minutes at 96 C). To amplify the K-ras DNA PCR buffer was added to a final concentration of 12 mM Tris/HCl, pH 8.0, 50 mM KCl, 0.1% Nonidet, 0.2 mM each dNTP and 2 mM MgCl2. The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C, 40s 58 C, 30s 70 C). The final extension was 5 minutes at 70 C. PCR products were analyzed via a constant denaturing gel electrophoresis (CDGE) using the DCode universal mutation detection system (Bio-Rad, Germany). Gels contained 35% denaturant, 1x TAE, 7.5% polyacrylamide (30:1) and were run for 240 minutes at 200 V, 60 C and silver stained. For sequencing, the deviant bands were cut out of the gel and the DNA was eluted by soaking in TE. After reamplification and TA cloning (Invitrogen, The Netherlands) several clones were sequenced (ABI PRISM Dye Terminator Cycle Sequencing kit/ ABI PRISM 310 automated sequencer, Applied Biosystems, Germany).


The calculated melting profile of the generated PCR fragment shows that it contains three melting domains. The putative mutations were in the second melting domain, which could not be analyzed without a GC clamp (the most stable domain) (Figure 1). The difference in melting profiles of the mutant and wt K-ras PCR-products should allow separation via CDGE (Figure 2). As controls we generated mutated sequences by PCR and cloning. Figure 3 shows a 2050% denaturant perpendicular DGGE gel run to determine the optimal denaturant concentration for the CDGE analysis, which was determined to be 35% (Figure 3). A 35% CDGE gel was run with samples from all mutations of codon 12 leading to an amino acid exchange and wt PCR products (Figure 4).

We analyzed 1,069 samples of 71 pancreases. Mutations were detected in 16 samples of 12 pancreases. With the exception of 2 samples of normal duct cells (243 screened) all the mutation-positive samples were from lesions (605 screened). All acinar cells screened (221) were negative. Figure 5 shows a typical result with one of the positive samples. In contrast to this low frequency, we could detect K-ras point mutations in more than 95% of ductal adenocarcinoma of the pancreas (data not shown).


Mutations of K-ras were thought to be quite rare in pancreases free of ductal adenocarcinoma. However, we detected mutations in 16 samples from normal pancreases. This finding raises the question which role K-ras mutations play in the series of genetic alterations leading to ductal adenocarcinoma of the pancreas. We believe it is a very early genetic change promoting cancer but not causing it. As K-ras mutations can be found in morphologically normal cells and in tumor free pancreases, caution should be used when interpreting findings of mutations in pancreatic juice [e.g. 6] or faeces.


1. Williams, J. R., Russel, J., Dicello, J. F., and Mabry, M. H., The genotype of the human cancer cell: implication for risk analysis, Mutat Res., 365, 1742, (1996).

2. Parker, S. L., Tong, T., Bolden, S., and Wingo, P. A., Cancer statistics, 1996, CA, Cancer J Clin 46, 527, (1996).

3. Chu, T. M., Molecular diagnosis of pancreas carcinoma, J. Clin. Lab. Anal. 11, 225231 (1997).

4. Klppel G., Gene Changes and Pancreatic Carcinoma: The Significance of K-ras, Dig. Surg., 11, 164169 (1994).

5. Brresen, A. L., Hovig, E., Smith-Sorensen, B., Malkin, D., Lystad, S., Andersen, T., Nesland, J., Isselbacher, K. J. and Friend, S., Constant denaturant gel electrophoresis as a rapid screening techique for p53 mutation, Proc. Natl. Acad. Sci., 88, 84058409 (1991).

6. Kondo, H., Sugano, K., Fukayama, N., Hosokawa, K., Ohkura, H., Ohtsu, A., Mukai, K., and Yoshida, S., Detection of K-ras gen mutations at codon 12 in the pancreatic juice of patients with intraductal papillary mucinous tumors of the pancreas, Cancer, 79, 900905 (1997).

back to top


Page: All 1 2 3 4

Related biology technology :

1. Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins
2. A New PCR-based Mycoplasma Detection Method
3. HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
4. Detection and Identification of Phosphorylation Sites in Proteins Using LC/MS/MS with Neutral Fragment Loss Mapping
5. Detection of mRNAs on Cryosections of the Cardiovascular System Using DIG-Labeled RNA Probes
6. Gene Expression Arrays: Highly Sensitive Detection of Expression Patterns with Improved Tools for Target Amplification
7. The DIG System Nonradioactive and Highly Sensitive Detection of Nucleic Acids
8. Quantitative Measurement of Cell Proliferation Using the BrdU ELISA: A Comparison Between Colorimetric and Chemiluminescent Detection
9. Quantification of Nucleosomes in Serum by the Cell Death Detection ELISAplus
10. A Further Step in Understanding Apoptosis Direct Detection of PARP Cleavage
11. In Situ Cell Death Detection Kit
Post Your Comments:

(Date:11/25/2015)... 2015 /PRNewswire/ - Aeterna Zentaris Inc. (NASDAQ:  AEZS; TSX: ... prospects remain fundamentally strong and highlights the following ... received DSMB recommendation to continue the ZoptEC Phase ... the final interim efficacy and safety data ... men with heavily pretreated castration- and Taxane-resistant prostate ...
(Date:11/25/2015)... ... November 25, 2015 , ... Jessica Richman and ... early in their initial angel funding process. Now, they are paying it forward ... make early stage investments in the microbiome space. In this, they join ...
(Date:11/24/2015)... , Nov. 24, 2015 Halozyme Therapeutics, Inc. (NASDAQ: ... Conference in New York on Wednesday, December ... Helen Torley , president and CEO, will provide a corporate overview. ... New York at 1:00 p.m. ET/10:00 a.m. PT . ... investor relations, will provide a corporate overview. --> th ...
(Date:11/24/2015)... 24, 2015 /PRNewswire/ - Aeterna Zentaris Inc. (NASDAQ:  AEZS) (TSX: ... behalf of the Toronto Stock Exchange, confirms that as ... no corporate developments that would cause the recent movements ... --> About Aeterna Zentaris Inc. ... --> Aeterna Zentaris is a specialty biopharmaceutical company ...
Breaking Biology Technology:
(Date:11/10/2015)... 10, 2015 About signature ... helps to identify and verify the identity of ... as the secure and accurate method of authentication ... particular individual because each individual,s signature is highly ... when dynamic signature of an individual is compared ...
(Date:10/29/2015)... 2015   MedNet Solutions , an innovative SaaS-based ... clinical research, is pleased to announce that it has ... as one of only three finalists for a ... and Growing" category. The Tekne Awards honor Minnesota ... technology innovation and leadership. iMedNet™ eClinical ...
(Date:10/29/2015)... Connecticut , October 29, 2015 ... a biometric authentication company focused on the growing ... smart wallet announces that StackCommerce, a leading marketplace ... be featuring the Wocket® smart wallet on StackSocial ... NXTD ) ("NXT-ID" or the "Company"), a biometric ...
Breaking Biology News(10 mins):