Navigation Links
Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

Martin A.O.H. Menke*, Axel Reinecke-Lthge*, Barbara Mllmann*, Angela Kellner, Jutta Lttges*, Gnter Klppel*
* Department of Pathology and Department of Hematopathology, Christian- Albrechts University Kiel, Michaelisstrae 11, D-24105 Kiel, Germany.


Introduction

Genetic alterations/variations are the cause underlying many non-neoplastic and probably all neoplastic diseases. Today the number of reports associating genetic alterations with cancer1 and other diseases is rapidly increasing. In many cases the exchange of only one or a few bases, so called point mutations, give rise to severe disease.

We are specifically interested in ductal adenocarcinoma of the exocrine pancreas, which is the second most frequent cause of death by digestive tract cancer.2 Nearly all of these tumors bear a point mutation in codon 12 of the K-ras protooncogene.3, 4 We wanted to determine the frequency of these mutations in ductal lesions and associated tissues of tumor free pancreases. We used microdissection followed by a sensitive single step PCR regime to amplify the exon 1 of the K-ras gene. Point mutations were detected by constant denaturing gel electrophoresis (CDGE)5 using the DCode universal mutation detection system.


Materials and Methods

Archived, formalin-fixed, paraffin-embedded pancreas tissue samples of patients without pancreatic ductal adenocarcinoma were drawn from the files of the Institute of Pathology. Evaluation of conservation was done by histological routine procedures. A section was stained with Hematoxylin & Eosin and used as reference. Cells were microdissected from an immediate corresponding unstained 10 m thick section using a micromanipulator (Narishige, Japan). For the aspiration of the lesions or morphologically normal cells capillaries of 1025 m diameter were used. The section was overlaid with TE, pH 8.0 (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). Aspiration only of the buffer served as contamination control. The aspirated cells/buffer were transferred to 5 l proteinase K digestion buffer (20 g proteinase K/ml in 10 mM Tris/HCl, 0.5% Nonidet P40) in PCR reaction vials. Digestion was performed for 10 minutes at 55 C to demask the DNA followed by an inactivation of the proteinase K (15 minutes at 96 C). To amplify the K-ras DNA PCR buffer was added to a final concentration of 12 mM Tris/HCl, pH 8.0, 50 mM KCl, 0.1% Nonidet, 0.2 mM each dNTP and 2 mM MgCl2. The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C, 40s 58 C, 30s 70 C). The final extension was 5 minutes at 70 C. PCR products were analyzed via a constant denaturing gel electrophoresis (CDGE) using the DCode universal mutation detection system (Bio-Rad, Germany). Gels contained 35% denaturant, 1x TAE, 7.5% polyacrylamide (30:1) and were run for 240 minutes at 200 V, 60 C and silver stained. For sequencing, the deviant bands were cut out of the gel and the DNA was eluted by soaking in TE. After reamplification and TA cloning (Invitrogen, The Netherlands) several clones were sequenced (ABI PRISM Dye Terminator Cycle Sequencing kit/ABI PRISM 310 automated sequencer, Applied Biosystems, Germany).


Results

The calculated melting profile of the generated PCR fragment shows that it contains three melting domains. The putative mutations were in the second melting domain, which could not be analyzed without a GC clamp (the most stable domain) (Figure 1). The difference in melting profiles of the mutant and wt K-ras PCR-products should allow separation via CDGE (Figure 2). As controls we generated mutated sequences by PCR and cloning. Figure 3 shows a 2050% denaturant perpendicular DGGE gel run to determine the optimal denaturant concentration for the CDGE analysis, which was determined to be 35% (Figure 3). A 35% CDGE gel was run with samples from all mutations of codon 12 leading to an amino acid exchange and wt PCR products (Figure 4).

We analyzed 1,069 samples of 71 pancreases. Mutations were detected in 16 samples of 12 pancreases. With the exception of 2 samples of normal duct cells (243 screened) all the mutation-positive samples were from lesions (605 screened). All acinar cells screened (221) were negative. Figure 5 shows a typical result with one of the positive samples. In contrast to this low frequency, we could detect K-ras point mutations in more than 95% of ductal adenocarcinoma of the pancreas (data not shown).


Discussion

Mutations of K-ras were thought to be quite rare in pancreases free of ductal adenocarcinoma. However, we detected mutations in 16 samples from normal pancreases. This finding raises the question which role K-ras mutations play in the series of genetic alterations leading to ductal adenocarcinoma of the pancreas. We believe it is a very early genetic change promoting cancer but not causing it. As K-ras mutations can be found in morphologically normal cells and in tumor free pancreases, caution should be used when interpreting findings of mutations in pancreatic juice [e.g. 6] or faeces.


References

1. Williams, J. R., Russel, J., Dicello, J. F., and Mabry, M. H., The genotype of the human cancer cell: implication for risk analysis, Mutat Res., 365, 1742, (1996).

2. Parker, S. L., Tong, T., Bolden, S., and Wingo, P. A., Cancer statistics, 1996, CA, Cancer J Clin 46, 527, (1996).

3. Chu, T. M., Molecular diagnosis of pancreas carcinoma, J. Clin. Lab. Anal. 11, 225231 (1997).

4. Klppel G., Gene Changes and Pancreatic Carcinoma: The Significance of K-ras, Dig. Surg., 11, 164169 (1994).

5. Brresen, A. L., Hovig, E., Smith-Sorensen, B., Malkin, D., Lystad, S., Andersen, T., Nesland, J., Isselbacher, K. J. and Friend, S., Constant denaturant gel electrophoresis as a rapid screening techique for p53 mutation, Proc. Natl. Acad. Sci., 88, 84058409 (1991).

6. Kondo, H., Sugano, K., Fukayama, N., Hosokawa, K., Ohkura, H., Ohtsu, A., Mukai, K., and Yoshida, S., Detection of K-ras gen mutations at codon 12 in the pancreatic juice of patients with intraductal papillary mucinous tumors of the pancreas, Cancer, 79, 900905 (1997).


back to top
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins
2. A New PCR-based Mycoplasma Detection Method
3. HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
4. Detection and Identification of Phosphorylation Sites in Proteins Using LC/MS/MS with Neutral Fragment Loss Mapping
5. Detection of mRNAs on Cryosections of the Cardiovascular System Using DIG-Labeled RNA Probes
6. Gene Expression Arrays: Highly Sensitive Detection of Expression Patterns with Improved Tools for Target Amplification
7. The DIG System Nonradioactive and Highly Sensitive Detection of Nucleic Acids
8. Quantitative Measurement of Cell Proliferation Using the BrdU ELISA: A Comparison Between Colorimetric and Chemiluminescent Detection
9. Quantification of Nucleosomes in Serum by the Cell Death Detection ELISAplus
10. A Further Step in Understanding Apoptosis Direct Detection of PARP Cleavage
11. In Situ Cell Death Detection Kit
Post Your Comments:
(Date:12/24/2014)... December 23, 2014 Pipette.com announces their ... Twitter followers can submit their #HolidayInTheLab pictures for a ... lab mates. , For those struggling to think of ... Pipette.com Holiday in the Lab Contest provides the ideal ... followers to send pictures of their chemistree, holiday ...
(Date:12/24/2014)... 23, 2014 Vermillion, Inc. (Nasdaq:   ... disease, announced today that investors including Oracle Investment ... LLC and several Vermillion directors have agreed to ... Vermillion,s common stock and warrants to purchase unregistered ... placement.  Under the terms of ...
(Date:12/24/2014)... LOUIS , Dec. 23, 2014 ... today that the waiting period under the Hart-Scott-Rodino ... the acquisition expired on December 22, 2014, thereby ... review requirement for the acquisition of the Company ... U.S. antitrust clearance satisfies another condition to closing ...
(Date:12/24/2014)... NEW YORK , Dec. 23, 2014  NeuroLifeSciences ... of mazindol in children with attention deficit/hyperactivity disorder published ... 2014 . The paper, titled "Pilot ... deficit/hyperactivity disorder" ( Konofal et al, Drug ... 2014 ) shows that mazindol might be an ...
Breaking Biology Technology:Major Pipette Distributor Pipette.com Announces their Holiday in the Lab Contest 2Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 2Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 3Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 4Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 5Acquisition of Sigma-Aldrich by Merck KGaA, Darmstadt, Germany, Receives U.S. Antitrust Clearance 2Acquisition of Sigma-Aldrich by Merck KGaA, Darmstadt, Germany, Receives U.S. Antitrust Clearance 3Redefining ADHD: A New Approach & A Shift of Paradigm in ADHD Therapeutics 2Redefining ADHD: A New Approach & A Shift of Paradigm in ADHD Therapeutics 3
... announces that a new market research report is ... Adds Global Top 10 Biotechnology Companies -- Industry, ... http://www.reportlinker.com/p0155124/Reportlinker-Adds-Global-Top-10-Biotechnology-Companies----Industry-Financial-and-SWOT-Analysis.html ... Companies Report: Strategic evaluation of industry and key ...
... October 16 , - New ... Brain Science and Used by the National Institutes of,Health, Will ... Elsevier, the leading publisher of scientific, ... showcase the new,features it is rolling out for its BrainNavigator ...
... Texas A team of scientists, led by a biomedical ... for the first time that mathematical models created ... correctly predict previously unknown cellular mechanisms. This brings biologists a ... control the inner workings of the cell as readily as ...
Cached Biology Technology:Reportlinker Adds Global Top 10 Biotechnology Companies -- Industry, Financial and SWOT Analysis 2Reportlinker Adds Global Top 10 Biotechnology Companies -- Industry, Financial and SWOT Analysis 3Reportlinker Adds Global Top 10 Biotechnology Companies -- Industry, Financial and SWOT Analysis 4Reportlinker Adds Global Top 10 Biotechnology Companies -- Industry, Financial and SWOT Analysis 5Elsevier's BrainNavigator Research Tool to Launch new Features at Neuroscience 2009 Show 2Elsevier's BrainNavigator Research Tool to Launch new Features at Neuroscience 2009 Show 3Elsevier's BrainNavigator Research Tool to Launch new Features at Neuroscience 2009 Show 4Elsevier's BrainNavigator Research Tool to Launch new Features at Neuroscience 2009 Show 5Scientists use math modeling to predict unknown biological mechanism of regulation 2
(Date:12/15/2014)... --Research and Markets ( http://www.researchandmarkets.com/research/87pph8/global_facial ) ... Facial Recognition Market 2015-2019" report to their ... Facial recognition is a technology used ... measures the overall facial feature of a person ... distance between eyes. Facial recognition is used for ...
(Date:12/10/2014)... You,ve been here before: you desperately need to ... password, site key or the answer to your secret question. ... Today, Hoyos Labs , a digital ... finally put an end to the frustration that comes with ... 1U leverages a user,s smartphone to acquire his or her ...
(Date:12/10/2014)... December 9, 2014   ... Platform   Jifflenow, ... scheduling solutions for business-to-business (B2B) events, today announced ... in mobile near-field communication (NFC), Bluetooth low energy ... (Logo: http://photos.prnewswire.com/prnh/20140612/691055) , Jifflenow will integrate ...
Breaking Biology News(10 mins):Global Facial Recognition Market 2015-2019: Key Vendors are 3M Cogent, Cognitec Systems, NEC and Safran Group 2Global Facial Recognition Market 2015-2019: Key Vendors are 3M Cogent, Cognitec Systems, NEC and Safran Group 3The Password is Finally Dead: Launch of 1U Mobile App Eliminates Need for All Usernames and Passwords 2The Password is Finally Dead: Launch of 1U Mobile App Eliminates Need for All Usernames and Passwords 3Jifflenow And ITN International Bring Cutting-Edge Badge Scanning Technology To B2B Events 2Jifflenow And ITN International Bring Cutting-Edge Badge Scanning Technology To B2B Events 3
... team of scientists have described twenty four new species of ... a further 24 species were known. The researchers, including two ... Southern America for ten years and they have now published ... Society ,. A ten-year study in forests of the ...
... alone were responsible for the demise of Australia,s iconic ... new study led by the University of Adelaide has ... study contradicts the widespread belief that disease must have ... thylacine was a unique marsupial carnivore found throughout most ...
... an eco-friendly fuel, but it is expensive to produce. ... moved a step closer to harnessing nature to produce ... chemistry professor Annabella Selloni, takes inspiration from bacteria that ... Selloni,s team uses computer models to figure out how ...
Cached Biology News:24 new species of flower fly have been found in Central and Southern America 2Disease not a factor in Tassie Tiger extinction 2
... is the cycler that revolutionized thermal ... and swappable blocks ensure consistent results, ... rugged machine is more than just ... new features and upgrades as research ...
Request Info...
Peroxidase Protective Buffer is a diluent formulated to stabilize the activity of Chemicon horseradish peroxidase (HRP)-antibody conjugates at high conjugate dilution for extended periods....
... Soybean-Casein Digest Medium (TSB), USP is a ... for general laboratory use. Due to the ... the medium will support growth of many ... etc. , Product conforms to United States ...
Biology Products: