Navigation Links
Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

Martin A.O.H. Menke*, Axel Reinecke-Lthge*, Barbara Mllmann*, Angela Kellner, Jutta Lttges*, Gnter Klppel*
* Department of Pathology and Department of Hematopathology, Christian- Albrechts University Kiel, Michaelisstrae 11, D-24105 Kiel, Germany.


Introduction

Genetic alterations/variations are the cause underlying many non-neoplastic and probably all neoplastic diseases. Today the number of reports associating genetic alterations with cancer1 and other diseases is rapidly increasing. In many cases the exchange of only one or a few bases, so called point mutations, give rise to severe disease.

We are specifically interested in ductal adenocarcinoma of the exocrine pancreas, which is the second most frequent cause of death by digestive tract cancer.2 Nearly all of these tumors bear a point mutation in codon 12 of the K-ras protooncogene.3, 4 We wanted to determine the frequency of these mutations in ductal lesions and associated tissues of tumor free pancreases. We used microdissection followed by a sensitive single step PCR regime to amplify the exon 1 of the K-ras gene. Point mutations were detected by constant denaturing gel electrophoresis (CDGE)5 using the DCode universal mutation detection system.


Materials and Methods

Archived, formalin-fixed, paraffin-embedded pancreas tissue samples of patients without pancreatic ductal adenocarcinoma were drawn from the files of the Institute of Pathology. Evaluation of conservation was done by histological routine procedures. A section was stained with Hematoxylin & Eosin and used as reference. Cells were microdissected from an immediate corresponding unstained 10 m thick section using a micromanipulator (Narishige, Japan). For the aspiration of the lesions or morphologically normal cells capillaries of 1025 m diameter were used. The section was overlaid with TE, pH 8.0 (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). Aspiration only of the buffer served as contamination control. The aspirated cells/buffer were transferred to 5 l proteinase K digestion buffer (20 g proteinase K/ml in 10 mM Tris/HCl, 0.5% Nonidet P40) in PCR reaction vials. Digestion was performed for 10 minutes at 55 C to demask the DNA followed by an inactivation of the proteinase K (15 minutes at 96 C). To amplify the K-ras DNA PCR buffer was added to a final concentration of 12 mM Tris/HCl, pH 8.0, 50 mM KCl, 0.1% Nonidet, 0.2 mM each dNTP and 2 mM MgCl2. The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C, 40s 58 C, 30s 70 C). The final extension was 5 minutes at 70 C. PCR products were analyzed via a constant denaturing gel electrophoresis (CDGE) using the DCode universal mutation detection system (Bio-Rad, Germany). Gels contained 35% denaturant, 1x TAE, 7.5% polyacrylamide (30:1) and were run for 240 minutes at 200 V, 60 C and silver stained. For sequencing, the deviant bands were cut out of the gel and the DNA was eluted by soaking in TE. After reamplification and TA cloning (Invitrogen, The Netherlands) several clones were sequenced (ABI PRISM Dye Terminator Cycle Sequencing kit/ABI PRISM 310 automated sequencer, Applied Biosystems, Germany).


Results

The calculated melting profile of the generated PCR fragment shows that it contains three melting domains. The putative mutations were in the second melting domain, which could not be analyzed without a GC clamp (the most stable domain) (Figure 1). The difference in melting profiles of the mutant and wt K-ras PCR-products should allow separation via CDGE (Figure 2). As controls we generated mutated sequences by PCR and cloning. Figure 3 shows a 2050% denaturant perpendicular DGGE gel run to determine the optimal denaturant concentration for the CDGE analysis, which was determined to be 35% (Figure 3). A 35% CDGE gel was run with samples from all mutations of codon 12 leading to an amino acid exchange and wt PCR products (Figure 4).

We analyzed 1,069 samples of 71 pancreases. Mutations were detected in 16 samples of 12 pancreases. With the exception of 2 samples of normal duct cells (243 screened) all the mutation-positive samples were from lesions (605 screened). All acinar cells screened (221) were negative. Figure 5 shows a typical result with one of the positive samples. In contrast to this low frequency, we could detect K-ras point mutations in more than 95% of ductal adenocarcinoma of the pancreas (data not shown).


Discussion

Mutations of K-ras were thought to be quite rare in pancreases free of ductal adenocarcinoma. However, we detected mutations in 16 samples from normal pancreases. This finding raises the question which role K-ras mutations play in the series of genetic alterations leading to ductal adenocarcinoma of the pancreas. We believe it is a very early genetic change promoting cancer but not causing it. As K-ras mutations can be found in morphologically normal cells and in tumor free pancreases, caution should be used when interpreting findings of mutations in pancreatic juice [e.g. 6] or faeces.


References

1. Williams, J. R., Russel, J., Dicello, J. F., and Mabry, M. H., The genotype of the human cancer cell: implication for risk analysis, Mutat Res., 365, 1742, (1996).

2. Parker, S. L., Tong, T., Bolden, S., and Wingo, P. A., Cancer statistics, 1996, CA, Cancer J Clin 46, 527, (1996).

3. Chu, T. M., Molecular diagnosis of pancreas carcinoma, J. Clin. Lab. Anal. 11, 225231 (1997).

4. Klppel G., Gene Changes and Pancreatic Carcinoma: The Significance of K-ras, Dig. Surg., 11, 164169 (1994).

5. Brresen, A. L., Hovig, E., Smith-Sorensen, B., Malkin, D., Lystad, S., Andersen, T., Nesland, J., Isselbacher, K. J. and Friend, S., Constant denaturant gel electrophoresis as a rapid screening techique for p53 mutation, Proc. Natl. Acad. Sci., 88, 84058409 (1991).

6. Kondo, H., Sugano, K., Fukayama, N., Hosokawa, K., Ohkura, H., Ohtsu, A., Mukai, K., and Yoshida, S., Detection of K-ras gen mutations at codon 12 in the pancreatic juice of patients with intraductal papillary mucinous tumors of the pancreas, Cancer, 79, 900905 (1997).


back to top
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins
2. A New PCR-based Mycoplasma Detection Method
3. HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
4. Detection and Identification of Phosphorylation Sites in Proteins Using LC/MS/MS with Neutral Fragment Loss Mapping
5. Detection of mRNAs on Cryosections of the Cardiovascular System Using DIG-Labeled RNA Probes
6. Gene Expression Arrays: Highly Sensitive Detection of Expression Patterns with Improved Tools for Target Amplification
7. The DIG System Nonradioactive and Highly Sensitive Detection of Nucleic Acids
8. Quantitative Measurement of Cell Proliferation Using the BrdU ELISA: A Comparison Between Colorimetric and Chemiluminescent Detection
9. Quantification of Nucleosomes in Serum by the Cell Death Detection ELISAplus
10. A Further Step in Understanding Apoptosis Direct Detection of PARP Cleavage
11. In Situ Cell Death Detection Kit
Post Your Comments:
(Date:9/19/2014)... Biotech companies make announcements illustrating ... systems and advanced Laboratory Instrumentation. Companies in focus today ... BDX ), Thermo Fisher Scientific Inc. (NYSE: ... RGDO ), Sangamo Biosciences Inc. (NASDAQ: SGMO ... BioSciences, Inc. (OTCQB: PBIO) ("PBI" or the "Company") today ...
(Date:9/19/2014)... Pfenex Inc. (NYSE MKT: PFNX), a clinical-stage ... difficult to manufacture proteins including biosimilar therapeutics, today announced ... Annual NewsMakers in the Biotech Industry conference in ... , chief executive officer of Pfenex, will provide an ... on Friday, September 26, 2014 at 10:00 a.m. EDT/7:00 ...
(Date:9/19/2014)... NC (PRWEB) September 19, 2014 ... Biobased Product Label for its Organic Cotton . ... product’s amount of renewable biobased ingredients meets or exceeds ... intermediate materials composed in whole or in significant part ... logo/label will allow our Organic cotton to be immediately ...
(Date:9/19/2014)... September 19, 2014 ... http://www.researchandmarkets.com/research/b2jxhs/micro_market ) has announced the addition of the  ...  report to their offering.       (Logo: ... one of the fastest-growing segments in the chromatography ... in 2013, and expected to reach $2.0 billion ...
Breaking Biology Technology:Medical Instrumentation Automation Advances for Biological Sample Preparation - Company Expects Q4 Revenue Impact from Newest Instrument Systems 2Medical Instrumentation Automation Advances for Biological Sample Preparation - Company Expects Q4 Revenue Impact from Newest Instrument Systems 3Medical Instrumentation Automation Advances for Biological Sample Preparation - Company Expects Q4 Revenue Impact from Newest Instrument Systems 4Medical Instrumentation Automation Advances for Biological Sample Preparation - Company Expects Q4 Revenue Impact from Newest Instrument Systems 5Medical Instrumentation Automation Advances for Biological Sample Preparation - Company Expects Q4 Revenue Impact from Newest Instrument Systems 6Medical Instrumentation Automation Advances for Biological Sample Preparation - Company Expects Q4 Revenue Impact from Newest Instrument Systems 7Pfenex to Present at Upcoming Industry Conference on September 26 2Barnhardt Manufacturing Company Earns USDA Certified Biobased Product Certification and Label for Organic Cotton 2Micro Market Monitor : Global Pre-packed Chromatography Columns 2
... ANGELES, Oct. 11, 2011 De Novo Software™, a ... solutions, and Nexcelom Bioscience, a leading supplier of cell ... announced today a licensing agreement enabling Nexcelom to distribute ...   Under the terms of the agreement, ...
... October 11, 2011 Edinburgh-based company 6S Ltd have ... service to store and retrieve digital media by replicating the simple ... patented technology is based on episodic memory - the memory which ... process of semantic tagging we are used to applying to digital ...
... inVentiv Health company, and a leading provider of physician ... today that it has changed its name to inVentiv ... organization – unveiled today at the Self-Insurance Institute of ... the company,s expanded solutions, revitalized mission and a commitment ...
Cached Biology Technology:Nexcelom Bioscience to Distribute FCS Express 4 Cytometry Software with Cellometer Vision CBA Instruments 2Digital Media Storage and Retrieval That Replicates the Functions of the Human Brain 2Digital Media Storage and Retrieval That Replicates the Functions of the Human Brain 3AWAC Becomes inVentiv Medical Management™ 2
(Date:9/19/2014)... -- Nxt-ID, Inc. (Nasdaq: NXTD and NXTDW) ("Nxt-ID" ... m-commerce market, updates the "Wocket in Your Pocket" celebrity ad campaign, ... middleweight weight classes, Vinny Pazienza (PAZ). ... of Thrones actor Ciaran Hinds and Sons ... Katey Sagal have been cast in Bleed for This ...
(Date:9/18/2014)... PULLMAN, Wash. - Washington State University researchers have developed ... sediment to power waste cleanup in rural areas. ... lead to an inexpensive and quick way to clean ... treatment plants while reducing pollution. , Professor Haluk ... College of Engineering and Architecture discuss the system in ...
(Date:9/18/2014)... BUFFALO, N.Y. A sleep-promoting circuit located deep in ... deep sleep. Discovered by researchers at Harvard School of ... and Biomedical Sciences, this is only the second "sleep ... to be both necessary and sufficient to produce deep ... Neuroscience , the study demonstrates that fully half of ...
Breaking Biology News(10 mins):NXT-ID's Vinny Paz Celebrity Ad Wocket Update: Katey Sagal and Ciaran Hinds Attached to His Upcoming Movie 2NXT-ID's Vinny Paz Celebrity Ad Wocket Update: Katey Sagal and Ciaran Hinds Attached to His Upcoming Movie 3Researchers develop unique waste cleanup for rural areas 2No sedative necessary: Scientists discover new 'sleep node' in the brain 2
... of aging in the nematode model organism C. elegans has provided ... whether genes involved in aging in the worm have a similar ... colleagues of McGill University (Canada) report that inactivation of the gene ... in increased cellular fitness and prolonged lifespan in mice. ...
... below your eyes. If you don't snooze, you lose a ... can't regenerate as quickly, the mind can't learn new words, ... gain things: a bad mood and increased risk for diabetes, ... sleep deprivation can be so serious that some sleep scientists ...
... offers additional insight into the evolutionary process by ... including New York University Biology Professor Richard Borowsky, ... that albinism in both populations was linked to ... common form of albinism in humans. They observed ...
Cached Biology News:Evolutionary conservation of a mechanism of longevity from worms to mammals 2Clocking in Pillow Time without the Pillow 2Clocking in Pillow Time without the Pillow 3Genetic analysis of cavefish reveals more about evolution 2
Immunogen: Tissue / cell preparation. (Murine EHS laminin preparation) Storage: -20 C, Avoid Freeze/Thaw Cycles...
p-Raf-1 (Ser 338/Tyr 341)-R...
Rabbit polyclonal to Syntrophin alpha 1 ( Abpromise for all tested applications). entrezGeneID: 6640 SwissProtID: Q13424...
... between P-selectin and P-selectin glycoprotein ligand-1 (PSGL-1) ... the lumenal surface of endothelial cells at ... primary role of PSGL-1 in mediating the ... well documented.MAB4092 completely blocks recognition of PSGL-1 ...
Biology Products: