Navigation Links
Constructing Directional cDNA Libraries from Limited Amounts of RNA

obtain a library with significant complexity that is representative of the starting material.

Materials and Methods PCR Conditions:

An ovarian tumor library was constructed using 100 ng of RNA from LCM-derived tissue. Ovarian cDNA library inserts were PCR amplified in 100-l reactions in 0.75-ml, thin-walled PCR tubes; reaction components were as specified in the kits manual. These reactions were amplified using the RoboCycler 96 temperature cycler and the following cycling conditions: 1 cycle of 93C for 5 minutes, 55C for 5 minutes, 72C for 4 minutes; 28 cycles of 93C for 1 minute, 55C for 1 minute, and 72C for 4 minutes; 1 cycle of 72C for 10 minutes.

Primer Sequences:

LIC-R-linker/primer: 5-(GA)6CTCGAGGAACAAGACCCGTTACTAGTAC(T)18-3
LIC-Right PCR primer: 5-GGAACAAGACCCGTTACTAGTACTT-3
LIC-Left PCR primer: 5-GACGACGACAAGTTAACGTCG-3

Acknowledgments

We thank Robert Buchner, Tim Sanchez, Jeff Mueller, Jeff Braman, and members of both the Genetic Systems Group and the Custom Library Group at Stratagene for suggestions and discussions.

REFERENCES

  1. Aslanidis, C. and de Jong, P.J. (1990) Nuc. Acids Res. 18: 6069-6074.

  2. Huan, R.S., Serventi, I.M., and Moss, J. (1992) BioTechniques 13: 515-518.

  3. Huan, R. and Moss, J. (1992) Gene 112: 37-43.

  4. Bonner, R.F., et al. (1997) Science 278: 1481-1483.

  5. Wyborski, D.L., et al. (1997) Strategies 10: 15-18.

  6. Hosfield, T., et al. (1997) Strategies 10: 68-69.


* U. S. Patent Nos. 5,512,468 and 5,707,841 and patents pending


'"/>

Source:


Page: All 1 2 3 4 5 6 7

Related biology technology :

1. Generate High-Quality, Directional Plasmid cDNA Libraries
2. Functional Cloning Using ViraPort Retroviral cDNA Expression Libraries
3. Assessing Gene Function with siRNA Libraries
4. Perform Microarray Analysis with Limited Bacterial RNA
5. Detecting Attomole Amounts of Small RNA
6. Rapidly Synthesize Large Amounts of Capped RNA

Post Your Comments:
(Date:11/24/2009)..., DUBLIN,November24/PRNewswire-FirstCall/--Shirep...harmaceuticalcompany,today,announcedthatithassubmi...asealfa,thecompany,senzymereplacementtherapyindeve...sthethirdmarketing,applicationforvelaglucerasealfa...UnitedStatesandCanada. , Basedonaglobalsupply...
(Date:11/24/2009)... Program Connects Customers wi...es Collected with DNA Genotek Products , ...09 -- DNA Genotek , a leading provider of product...and preparation, today announced its new global pa...ncements for DNA Genotek,s partner community and i...
(Date:11/23/2009)...MPAIGN, Ill. You can think of it as origami very...ty of Illinois have developed a technique for fabr...con structures from thin films by coupling photoli...illary interactions. , The films, only a few micr...t possible with thicker pieces of the same materia...
(Date:11/23/2009)..., MISSISSAUGA,ON,Nov.23/PRNewswire-FirstCall/-YMB...sproductdevelopmentcompanythatidentifiesandadvance...satvariousstagesofdevelopment,todayreportedthatCyt...alevaluatingCYT387,apotent,orally-administeredJAK1...cinRochester,Minnesota.AproposaltomergeCytopiainto...
Breaking Biology Technology:Shire Submits European Marketing Authorization Application (MAA) for velaglucerase alfa for the Treatment of Type 1 Gaucher Disease 2Shire Submits European Marketing Authorization Application (MAA) for velaglucerase alfa for the Treatment of Type 1 Gaucher Disease 3DNA Genotek Launches Global Partner Program 2DNA Genotek Launches Global Partner Program 3Water droplets direct self-assembly process in thin-film materials 2YM BIOSCIENCES REPORTS FIRST PATIENT IN PHASE I/II TRIAL OF JAK1/JAK2 INHIBITOR, CYT387 ENROLLED BY CYTOPIA 2YM BIOSCIENCES REPORTS FIRST PATIENT IN PHASE I/II TRIAL OF JAK1/JAK2 INHIBITOR, CYT387 ENROLLED BY CYTOPIA 3YM BIOSCIENCES REPORTS FIRST PATIENT IN PHASE I/II TRIAL OF JAK1/JAK2 INHIBITOR, CYT387 ENROLLED BY CYTOPIA 4
...April 3, 2008 Alba Therapeutics Corporation,today...its Chief Executive,Officer (CEO) and a member of ...artner with SV Life Sciences Advisors, LLC. Previo...senior management team for several,successful entr...apeutic,diagnostic and service areas including The...
...ril 3, 2008 A policy comment in Science,today quo... explicit claims about the utility of CYP450,testi...lex that,pharmacogenetic testing is "required to e...dna.com/professional/paxil.html )., The actual st...rough CYP2D6. Pharmacogenetic,testing of this path...
...evelopment Agreement to Produce Reference Standard... Research, NEWARK, Del., April 3, 2008 Strategic...providing advanced antibody,products and services ...s,been selected by Science Applications Internatio...onoclonal antibodies for the Proteomics Reagents &...
Other Biology Technology:Alba Therapeutics Announces Appointment of Bruce A. Peacock as its Chief Executive Officer 2Science Fuels DNA Testing Controversy with Prejudicial Misquote 2Strategic Diagnostics Inc. Selected as Key Supplier to SAIC-F and the National Cancer Institute for the Development of a Comprehensive Portfolio of Antibodies for Use in Cancer Research 2Strategic Diagnostics Inc. Selected as Key Supplier to SAIC-F and the National Cancer Institute for the Development of a Comprehensive Portfolio of Antibodies for Use in Cancer Research 3
(Date:11/23/2009)... studies reveal in unprecedented detail how the ri...new proteins and guide them toward their destinati... dynamics flexible fitting (MDFF) to examine the i...cular partners. , The first study, in Proceedi... the intimate signaling between the ribosome and a...
(Date:11/23/2009)...g of recent discoveries about the multiple health ... multi-purpose nutrient, increased awareness of th...spurred research and even led to an appreciation o...ng from the health of your immune system to preven...fluenza, vitamin D is now seen as one of the most ...
(Date:11/23/2009)..., , , , , , , ,...O: , Dr Andrew Marshall, from the Environment...he discovery of Kinyongia magomberae and his wid...re for more information. , , , , ... , , , , , , , A new species ...
Breaking Biology News(10 mins):Computational microscope peers into the working ribosome 2Computational microscope peers into the working ribosome 3Multiple health concerns surface as winter, vitamin D deficiences arrive 2Multiple health concerns surface as winter, vitamin D deficiences arrive 3New chameleon species discovered in East Africa 2New chameleon species discovered in East Africa 3Webmedx Appoints New Senior Vice President of Client Development Chris Cashwell 52271 1Webmedx Appoints New Senior Vice President of Client Development Chris Cashwell 52271 2Smart Ideas at the Intersection of Transportation Health and Equity 52268 1Smart Ideas at the Intersection of Transportation Health and Equity 52268 2Smart Ideas at the Intersection of Transportation Health and Equity 52268 3Smart Ideas at the Intersection of Transportation Health and Equity 52268 4GVI Security Solutions Samsung Video Surveillance Solution Selected by North East Pharmacy Chain 52265 1GVI Security Solutions Samsung Video Surveillance Solution Selected by North East Pharmacy Chain 52265 2
...tes and other northern mid- and upper-latitude reg...al warming than previously thought, according to a...which sheds light on the so-called missing carbon ...emoving an unexpectedly high proportion of carbon ...carbon entering the air through industrial emissio...
...ntiviral Tamiflu (oseltamivir) and prophylaxis for...of the most cost-effective strategies for reducing...ccording to modelling research presented by Beate ... of Tamiflu sufficient to cover 65% of a country’s.... This study was announced at the leading influenz...
...sity of California, San Diego (UCSD) Skaggs School...nted a strategy for developing a human vaccine to ...tion and disease. , CMV, a type of herpes virus,... serious problem in patients with compromised immu...rotect against infection by the virus, estimated t...
Other Biology News:Scientists close in on missing carbon sink 2Scientists close in on missing carbon sink 3Experts predict Tamiflu could halve the pandemic influenza death toll versus no intervention 2New vaccine prevents CMV infection and disease in mice 2New vaccine prevents CMV infection and disease in mice 3
...system combines world-class performance hardware, ...ftware, Agilents world-renowned support and column...lies--a combination that lets you reach uncompromi...sed on dependable data. The Agilent 6820 GC system...
7890A GC from Agilent Technologies
RF-5301 Fluorescence Spectrophotometer from Shimadzu
Kit for BASE20/50 dual control unit KIT50EHTD from Wave Biotech now part of GE Healthcare
Biology Products: