Navigation Links
Constructing Directional cDNA Libraries from Limited Amounts of RNA

obtain a library with significant complexity that is representative of the starting material.

Materials and Methods PCR Conditions:

An ovarian tumor library was constructed using 100 ng of RNA from LCM-derived tissue. Ovarian cDNA library inserts were PCR amplified in 100-l reactions in 0.75-ml, thin-walled PCR tubes; reaction components were as specified in the kits manual. These reactions were amplified using the RoboCycler 96 temperature cycler and the following cycling conditions: 1 cycle of 93C for 5 minutes, 55C for 5 minutes, 72C for 4 minutes; 28 cycles of 93C for 1 minute, 55C for 1 minute, and 72C for 4 minutes; 1 cycle of 72C for 10 minutes.

Primer Sequences:

LIC-R-linker/primer: 5-(GA)6CTCGAGGAACAAGACCCGTTACTAGTAC(T)18-3
LIC-Right PCR primer: 5-GGAACAAGACCCGTTACTAGTACTT-3
LIC-Left PCR primer: 5-GACGACGACAAGTTAACGTCG-3

Acknowledgments

We thank Robert Buchner, Tim Sanchez, Jeff Mueller, Jeff Braman, and members of both the Genetic Systems Group and the Custom Library Group at Stratagene for suggestions and discussions.

REFERENCES

  1. Aslanidis, C. and de Jong, P.J. (1990) Nuc. Acids Res. 18: 6069-6074.

  2. Huan, R.S., Serventi, I.M., and Moss, J. (1992) BioTechniques 13: 515-518.

  3. Huan, R. and Moss, J. (1992) Gene 112: 37-43.

  4. Bonner, R.F., et al. (1997) Science 278: 1481-1483.

  5. Wyborski, D.L., et al. (1997) Strategies 10: 15-18.

  6. Hosfield, T., et al. (1997) Strategies 10: 68-69.


* U. S. Patent Nos. 5,512,468 and 5,707,841 and patents pending


'"/>

Source:


Page: All 1 2 3 4 5 6 7

Related biology technology :

1. Generate High-Quality, Directional Plasmid cDNA Libraries
2. Functional Cloning Using ViraPort Retroviral cDNA Expression Libraries
3. Assessing Gene Function with siRNA Libraries
4. Perform Microarray Analysis with Limited Bacterial RNA
5. Detecting Attomole Amounts of Small RNA
6. Rapidly Synthesize Large Amounts of Capped RNA
Post Your Comments:
(Date:12/2/2008)...DOWN, England and SAN FRANCISCO, Dec. 2 /PRNewswir...oint-of-care molecular diagnostics company, announ...Francisco and the appointment of Chris Melancon as... The San Francisco office opened on December 1 and...o commercialize Enigma,s range of rapid diagnostic...
(Date:12/2/2008)...E, Calif., Dec. 2 Starch Medical I...rer, announces the CE approval of its,PerClot(TM)...arFoam(TM),Absorbable Polysaccharide Hemostat. I... month in the European Union and other select inte...lysaccharide Hemostat will launch,during the 2nd ...
(Date:12/2/2008)...TO, Calif., Dec. 2 Intradigm Corpo... RNA interference (RNAi) therapeutics, today,anno...47, entitled "Methods,and Compositions for Contro...ent, which is based on the seminal research of Phi...of Biomedical Sciences and Professor of Biochemist...
(Date:12/2/2008)..., Dec. 2 /PRNewswire-Asia/ -- Sinovac Biotech Ltd....vaccines in China, announced today that, the,Heal... of Beijing suspended,the use of 83 doses of inac...a,report of the death of a minor in the Fengtai D...h the administration of the vaccine two days prior...
Breaking Biology Technology:Enigma Diagnostics Announces the Opening of a United States Office 2Enigma Diagnostics Announces the Opening of a United States Office 3Starch Medical Launches New, Bioinert Surgical Hemostats 2Intradigm Announces Issuance of Key Patent Related to Enhancing Efficacy and Potency of RNAi Therapeutics 2Intradigm Announces Issuance of Key Patent Related to Enhancing Efficacy and Potency of RNAi Therapeutics 3Sinovac Releases Statement on Healive Vaccine Suspension 2
...is. - Mithridion, Inc. , a biopharmaceutical sta...ess of Alzheimer,s disease, has secured $296,800 i...ates. , ,The twin grants, awarded by the National...al Institutes of Health , will be used to prove th...pany will apply for the next phase of NIH small bu...
... Wis. - In Thomas Friedman,s 2005 New York Tim...man is author of the book "The World is Flat: A Br...rasts a personal trip in 2004 to India to Columbus...ld the Spanish king and queen that "the world is r... world, in fact, is not round but flat. , ,Friedma...
..., Wis. - Three northwestern Wisconsin colleges ar...ic field of nanotechnology, and perhaps producing ... ,The colleges, with help from the National Scien...he finishing touches on a nanotechnology curriculu...ecule-sized machines. , ,"Nanotechnology is still ...
...is. - The WiCell Research Institute , the non-pr...ling all 21 federally funded stem cell lines in th...ive director. , ,Donley, who led litigation and pa...ounsel, is now implementing its growth strategy an...ommercialize stem cell technology is igniting acro...
Other Biology Technology:Mithridion wins grants for Alzheimer's research 2Mithridion wins grants for Alzheimer's research 3The flattening world and its impact on U.S. biotech 2The flattening world and its impact on U.S. biotech 3The flattening world and its impact on U.S. biotech 4The flattening world and its impact on U.S. biotech 5The flattening world and its impact on U.S. biotech 6Wisconsin colleges secure funding for nanotechnology 2Donley has growth plans for stem cell bank 2Donley has growth plans for stem cell bank 3
(Date:12/2/2008)...is hampering the long-term recovery of rivers from...ting improvements, according to a new study by Car...eve Ormerod and Dr Isabelle Durance of the School ...ound Llyn Brianne in mid-Wales. Their findings are...Society,s Journal of Applied Ecology . , Carri...
(Date:12/2/2008)...s available in French . , Plant researchers...fornia, Berkeley, have announced a major breakthro... They have demonstrated for the first time the rev...ants. , The findings are important to develop a...ntinuing quest to breed enhanced crops that produc...
(Date:12/2/2008)..., 2008 Scientists and engineers from two of the n...ill come together Dec. 8, along with academicians ...es in moving oil and pumping blood. , Much lik...mp blood through the body. Both systems need clea... of blockages or corrosion, to function with incre...
(Date:12/2/2008)...sts or fields to biofuel crops can increase or dec... and which biofuel crops are used, University of...esearchers analyzed data from dozens of studies to...uence the carbon content of the soil. Their findin... Biology Bioenergy . , Plants use the sun,s ener...
Breaking Biology News(10 mins):Climate change setback for acidified rivers 2Plants display 'molecular amnesia' 2Plants display 'molecular amnesia' 3Using the other guy's toolkit: Similarities of pumping blood, oil examined 2Replacing corn with perennial grasses improves carbon footprint of biofuels 2Replacing corn with perennial grasses improves carbon footprint of biofuels 3Boston Scientific Announces CE Mark Approval for Next Generation Cardiac Resynchronization Therapy Defibrillator 8892 1Boston Scientific Announces CE Mark Approval for Next Generation Cardiac Resynchronization Therapy Defibrillator 8892 2Boston Scientific Announces CE Mark Approval for Next Generation Cardiac Resynchronization Therapy Defibrillator 8892 3MSC Names Paul Bode as Senior Vice President Ancillary Sales 8890 1Caraco Pharmaceutical Laboratories Ltd Announces FDA Approval to Market Generic OTC Versions of Zyrtec Allergy Tablets 28R 29 and Zyrtec Hives Relie 8888 1Caraco Pharmaceutical Laboratories Ltd Announces FDA Approval to Market Generic OTC Versions of Zyrtec Allergy Tablets 28R 29 and Zyrtec Hives Relie 8888 2Maxygen to Present at the JPMorgan 26th Annual Healthcare Conference 2401 1
...hers and doctors, not to mention the cleaning prod...t a Stanford University School of Medicine microbi...tent bacterial and viral infections have benefits..... Cahill Professor in Cancer Research, is publishi...eb. 24 issue of the journal Cell, in which he asks...
... Trends in Biotechnology, scientists and doctors w...ine (PCRM) recommend using only animal serum-free ...ue is the use of fetal calf serum, which is obtain... anesthesia. Recent breakthroughs permit the growt... enabling scientists and researchers to make cell ...
... other than by word of mouth, and still the Univer...icine was overwhelmed with requests. Since 1998, ...g an anti-cancer vaccine for dogs diagnosed with m...tment, dog owners from all over the nation have wa...ance that this would help their pet. , After promi...
...ary analysis that included cognitive, neurophysiol...m found both a low-level viral infection in the br...n in order to protect against the virus. , "As in...chieve a level of control of the virus, but are un...ociate professor at Scripps Research and director ...
Other Biology News:Learning to love bacteria: Stanford scientist highlights bugs' benefits 2Learning to love bacteria: Stanford scientist highlights bugs' benefits 3Canine cancer vaccine program shows early promise 2Immune response to HIV in the brain 2
Harmful, Irritant, Combustible ,DEPC
Rabbit polyclonal to JMJD2D ( Abpromise for all tested applications). Antigen: Synthetic peptide conjugated to KLH derived from within residues 400 - 500 of Human JMJD2D.(Note: the amino acid se
Permeabilization Solution, 5X
Cytofix/Cytoperm Kit 250 Tests
Biology Products: