Navigation Links
Cancer siRNA Oligo Set Version 1.0

YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
TAG: Cancer siRNA Oligo Set Version

(Date:10/22/2014)... The Americas Inorganic Refrigerants Market report defines ... with analysis and forecast of revenue. , Browse ... Market report, to get an idea of the ... of the segmentation in the Americas inorganic refrigerants ... figures. , , Inorganic ...
(Date:10/22/2014)... 22, 2014 Currently offering a ... & D Weighing, Rice Lake, and Ohaus, ... . The Sartorius CPA Semi-Micro Balance is ideal ... precise, and user-friendly laboratory balance. , Sartorius is ... their laboratory balances are well known for their ...
(Date:10/22/2014)... , Oct. 22, 2014 /PRNewswire/ - iCo Therapeutics ("iCo" ... announced next steps for its Oral Amphotericin B ... its in vitro work involving samples ... now plans to complete pre clinical studies and ... Phase 1A clinical trial, utilizing approximately $700,000 of ...
(Date:10/20/2014)... , Oct. 20, 2014 Mapp ... experimental ZMapp™ antibody therapeutic to fight the Ebola ... difficult and time-consuming the production of pharmaceuticals can ... research publisher said that while some may be ... this compound, those with industry knowledge are well ...
Breaking Biology Technology:The Americas Inorganic Refrigerants Market is estimated to grow to $71.6 million by 2018 - New Report by MicroMarket Monitor 2The Americas Inorganic Refrigerants Market is estimated to grow to $71.6 million by 2018 - New Report by MicroMarket Monitor Launches the Addition of Sartorius CPA Semi-Micro Balance to Their Product Portfolio with Special Promotional Pricing Launches the Addition of Sartorius CPA Semi-Micro Balance to Their Product Portfolio with Special Promotional Pricing 3iCo Therapeutics Announces Advancement of Oral Amphotericin B Program 2iCo Therapeutics Announces Advancement of Oral Amphotericin B Program 3Kalorama: ZMapp Highlights Need For Faster Biopharmaceutical Production 2Kalorama: ZMapp Highlights Need For Faster Biopharmaceutical Production 3
... Calif., June 23, 2011 Nile Therapeutics, Inc. (OTCQB: ... heart failure patients, today announced that it has completed ... securities consisting of an aggregate of 5,000,000 shares of ... 2,500,000 shares of common stock for aggregate gross proceeds ...
... 2011 GeoVax Labs, Inc. (OTCQB/OTCBB: GOVX), ... HIV/AIDS vaccines, announced today the opening of a third ... vaccine.  The Los Angeles-based AIDS Research Alliance (ARA) will ... site team: the AIDS Research Consortium of Atlanta and ...
... NEW YORK, June 22, 2011 Veredus Laboratories, a ... partner, STMicroelectronics (NYSE: STM ), today announced ... application that is able to detect 10 to 12 ... Escherichia coli (E. coli) responsible for the ...
Cached Biology Technology:Nile Therapeutics, Inc. Completes $2.5 Million Private Placement 2Nile Therapeutics, Inc. Completes $2.5 Million Private Placement 3GeoVax Initiates Third Site For Therapeutic Testing of Its HIV Vaccine 2GeoVax Initiates Third Site For Therapeutic Testing of Its HIV Vaccine 3GeoVax Initiates Third Site For Therapeutic Testing of Its HIV Vaccine 4Veredus Laboratories Develops Lab-on-Chip Solution to Detect and Differentiate Several Food-Borne Pathogens, Including Escherichia coli (E. coli) 2Veredus Laboratories Develops Lab-on-Chip Solution to Detect and Differentiate Several Food-Borne Pathogens, Including Escherichia coli (E. coli) 3Veredus Laboratories Develops Lab-on-Chip Solution to Detect and Differentiate Several Food-Borne Pathogens, Including Escherichia coli (E. coli) 4
(Date:10/16/2014)... 2014 NXT-ID, Inc. (NASDAQ: NXTD ... authentication company focused on the growing mobile commerce market ... Wocket™, the Smart Wallet, at the 13 th ... leading global conference on the intersection of technology and ... Anderson , founder and publisher of the Strategic News ...
(Date:10/15/2014)... ,Models of Life, is a non-traditional biophysics textbook and ... book is a journey of discovery into biological systems ... and biological regulation. It is about how our genes ... between the billions of cells in an organism. It ... between principles, which can be found on both large ...
(Date:10/15/2014)... in female mice to an enzyme activated by the ... resistant to respiratory infections than males. Now, an international ... bacterial pneumonia in female mice is linked to the ... that this enzyme is ultimately activated by the release ... lead by Professor Lester Kobzik at the Harvard University ...
Breaking Biology News(10 mins):NXT-ID Inc. to Present at 13th Annual FiRe Conference 2NXT-ID Inc. to Present at 13th Annual FiRe Conference 3New book about life as seen from physics 2
... from L-1 and Terminates Discussions ... ... ("L-1") (NYSE: ID ), a leading provider of identity solutions ... with Digimarc Corporation ("Digimarc") (Nasdaq: DMRC ). The,proposed transaction values ...
... Calif., June 30, 2008--In a breakthrough scientific study published ... of Sciences , scientists at the Burnham Institute for ... may be linked to Autism. The study demonstrated that ... in neural stem cells had smaller brains, fewer nerve ...
... College of Medicine and her colleagues discovered the first ... the intestines, causing diarrhea. The next step ... through which the enterotoxin interacts to cause diarrhea. ... be straightforward," said the professor of molecular virology and ...
Cached Biology News:Digimarc Board Approves $310 Million All-Cash Offer from L-1 Identity Solutions for Digimarc's ID Systems Business 2Digimarc Board Approves $310 Million All-Cash Offer from L-1 Identity Solutions for Digimarc's ID Systems Business 3Digimarc Board Approves $310 Million All-Cash Offer from L-1 Identity Solutions for Digimarc's ID Systems Business 4Digimarc Board Approves $310 Million All-Cash Offer from L-1 Identity Solutions for Digimarc's ID Systems Business 5Digimarc Board Approves $310 Million All-Cash Offer from L-1 Identity Solutions for Digimarc's ID Systems Business 6Digimarc Board Approves $310 Million All-Cash Offer from L-1 Identity Solutions for Digimarc's ID Systems Business 7Researchers link early stem cell mutation to autism 2Integrins as receptors give insight into rotavirus and diarrhea 2
Request Info...
Loading Buffer...
Epi-Grids™ Colony Grid Templates are easy-to-use griding templates that allow rapid organization of colonies from initial screening plates and for preparing precise master plates....
Request Info...
Biology Products: