Navigation Links
Cancer siRNA Oligo Set Version 1.0

TIAM1
TLX1
TNFRSF1B
TNFRSF6 TP53
VAV1
VHL
WNT1
WNT2
WNT5A
WNT7B
WT1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
symbol
Accession # Unigene Target
location
Coding
region
siRNA target %GC
ABCB1
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52

'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Cancer siRNA Oligo Set Version

(Date:7/24/2008)... ALEXANDRIA, Va., July 24 /- The...blished in 2004 by Groupe DANONE and Yakult Honsha...ceive the inaugural Young,Investigator Grant for P...,created to identify young rising stars who will c...tics and gut microbiota research in the United,Sta...
(Date:7/24/2008)... SHELTON, Conn., July 24 /- Cara...osed on $12.3 million of additional funding,to its... completed in 2007.,The round was led by new inves...ation by Connecticut Innovations. Previous investo...medical Ventures, Mitsubishi International,Corpora...
(Date:7/24/2008)... ST. LOUIS, July 24 /-... it has received regulatory approvals for Roundup,...d New Zealand. In,addition, the company noted the ... positive scientific opinion concluding Roundup Re...undup Ready 2 Yield soybeans are the,second genera...
(Date:7/24/2008)... REHOVOT, Israel and JERSEY CITY, New Jersey,...s Ltd. (Nasdaq: ROSG ), a leader in,the developme... announced,today that it has successfully complete... Inc. ("Parkway"), a privately-held company owning...vania, for an aggregate,purchase price of $2,900,0...
Breaking Biology Technology:Global Probiotics Council Announces First Awardees for New Young Investigator Grant for Probiotics Research 2Global Probiotics Council Announces First Awardees for New Young Investigator Grant for Probiotics Research 3Global Probiotics Council Announces First Awardees for New Young Investigator Grant for Probiotics Research 4Cara Therapeutics Secures $12.3 Million in Series C Extension Financing 2Monsanto Announces Key Regulatory Approvals for Roundup Ready 2 Yield(TM) Soybeans; Product Remains on Track for 2009 Launch 2Rosetta Genomics Completes Acquisition of Parkway Clinical Laboratories Inc. 2Rosetta Genomics Completes Acquisition of Parkway Clinical Laboratories Inc. 3Rosetta Genomics Completes Acquisition of Parkway Clinical Laboratories Inc. 4Rosetta Genomics Completes Acquisition of Parkway Clinical Laboratories Inc. 5
...ic has embarked on a novel project to match genet...ronmental factors that may contribute to the disea...e more than 18,000 DNA samples Marshfield Clinic h... Project, one of the nation,s largest bio-banking ...tabase of electronic medical records, the project ...
...oration , a California life-science firm, announce... Technologies Inc. , in Madison, over a patent iss...ologies last September. , ,The technologies involv...tratagene,s FullVelocity. Both are molecular diagn...FullVelocity allows researchers to make copies of ...
...lth care costs continue to rise, the need for the ...change potential of the Internet has never been mo...h Information Exchange (WHIE) has joined more tha...untry in the mammoth task of creating localized sy...nd home health-care providers can share patient in...
...he historical significance of this past Sunday? , ...h anniversary of V-E Day ("Victory in Europe"), bu...f Friedrich Hayek. He is one of the world,s greate...emembered for his destruction of socialist hokum i...lso a former professor of social and moral science...
Other Biology Technology:Marshfield study mixes DNA into electronic medical record to screen for Alzheimer's 2Marshfield study mixes DNA into electronic medical record to screen for Alzheimer's 3Wisconsin Health Information Exchange shares burden of electronic medical records 2Wisconsin Health Information Exchange shares burden of electronic medical records 3Wisconsin Health Information Exchange shares burden of electronic medical records 4Wisconsin Health Information Exchange shares burden of electronic medical records 5Midwest cities in fight over municipal broadband access 2Midwest cities in fight over municipal broadband access 3Midwest cities in fight over municipal broadband access 4
(Date:7/24/2008)...008 A new study by researchers from Columbia Univ... one of the most challenging issues in infant heal... in poor countries. In these settings, HIV-infect...ome for their infants, they should exclusively bre...months after birth. But according to the study con...
(Date:7/24/2008)...s at The Pennsylvania State University College of ...at the efficacy of imiquimod, a clinically importa...and antitumor activity, is dependent on the Opioid...its action. This discovery, reported in the Augus... provides new insights into a widely used drug tha...
(Date:7/24/2008)... Mass. -- Scientists at Harvard University and the...etic evolution is strongly shaped by genes, effort...ion. , Their study also suggests that the cost o...ormed proteins themselves, rather than the loss of... up in long-lived cells, like neurons, and cause n...
(Date:7/24/2008)...S / ST. PAUL (July 24, 2008) A multi-institutiona... University of Minnesota Medical School, have deve...icine. The robust method will allow researchers to...nipulate DNA sequences for inactivation or repair.... Voytas, Ph.D., director of the Arnold and Mabel B...
Breaking Biology News(10 mins):Early cessation of breastfeeding by HIV+ women in poor countries and child survival 2Early cessation of breastfeeding by HIV+ women in poor countries and child survival 3Imiquimod, an immune response modifier, is dependent on the OGF-OGFr signaling pathway 2Various species' genes evolve to minimize protein production errors 2Various species' genes evolve to minimize protein production errors 3Consortium develops new method to manipulate genetic material 2DURECT Corporation Invites You to Join Its First Quarter 2008 Earnings Conference Call 17918 1Statement from Lighthouse International About the Study on Gene Therapy Concerning Lebers Congenital Amaurosis 4937 1Aflac and the American Association for Cancer Research Unite to Issue Inaugural Aflac Career Development Award for Childhood Cancer Research 4933 1Aflac and the American Association for Cancer Research Unite to Issue Inaugural Aflac Career Development Award for Childhood Cancer Research 4933 2Aflac and the American Association for Cancer Research Unite to Issue Inaugural Aflac Career Development Award for Childhood Cancer Research 4933 3Alexza Announces Positive Phase 1 Results With AZ 007 28Staccato 28R 29 Zaleplon 29 1919 1Alexza Announces Positive Phase 1 Results With AZ 007 28Staccato 28R 29 Zaleplon 29 1919 2Alexza Announces Positive Phase 1 Results With AZ 007 28Staccato 28R 29 Zaleplon 29 1919 3Alexza Announces Positive Phase 1 Results With AZ 007 28Staccato 28R 29 Zaleplon 29 1919 4
...can Society of Plastic Surgeons (ASPS) and the Ame...M) today unveiled a landmark joint document, Facia... assist plastic surgeons considering participation...truly a remarkable and historic time in plastic su...nt. "The ability to help restore some hope to a pe...
...ic researchers at The Zucker Hillside Hospital cam...h have uncovered evidence of a gene that appears t...ith researchers at Harvard Partners Center for Gen...team examined the genetic blueprints of individual...characterized by cognitive impairment, and compare...
...are bad. Mothers and doctors, not to mention the c... dangers. But a Stanford University School of Medi... that persistent bacterial and viral infections ha...and Vivian K. Cahill Professor in Cancer Research,...say in the Feb. 24 issue of the journal Cell, in w...
...f seven tropical forests around the world has reve...ng the growth of less common trees. The landmark s... and published in the Jan. 27 issue of the journal... matters and has ecological importance to tropical...fessor of ecology in the University of Minnesota,s...
Other Biology News:Feinstein researchers identify intelligence gene 2Learning to love bacteria: Stanford scientist highlights bugs' benefits 2Learning to love bacteria: Stanford scientist highlights bugs' benefits 3Underdogs in the understory: Study suggests nature favors rarer trees 2
...of Caspase/DIABLO Liquid. In 100 mM KCl, 20 mM H...residues 56 - 239 of human Smac/DIABLO with a carb...essed in and purified from E. coli . Smac/DIABLO ...osis and promotes caspase activation through the n...
Sheep polyclonal to Decorin ( Abpromise for all tested applications). Antigen: Synthetic peptide: IGPEVPDDRDFEPS conjugated to KLH, corresponding to amino acids 6-19 of Human Decorin (fragment 3
GLP expression profiling service on the Affymetrix platform. Starting material can be blood, tissue or RNA. 5 day turnaround. Standard and custom post analyses of microarray data available.
...croscopy-based imaging system that accurately coun... calculates cell viability, in a single test. By ...associated with the subjective interpretation of m...nt ViaSure Kit, up to six tests at a time can be p...
Biology Products: