Navigation Links
Cancer siRNA Oligo Set Version 1.0

TIAM1
TLX1
TNFRSF1B
TNFRSF6 TP53
VAV1
VHL
WNT1
WNT2
WNT5A
WNT7B
WT1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
symbol
Accession # Unigene Target
location
Coding
region
siRNA target %GC
ABCB1
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52

'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Cancer siRNA Oligo Set Version

(Date:1/22/2015)... Nueva Jersey , 22 de enero de 2015 ... Research abre hoy su llamada a nominaciones para 2015. ... científica ha hecho, o tiene el potencial para hacer, ... Las nominaciones se aceptarán hasta el 15 de marzo ...
(Date:1/22/2015)...  Derma Sciences, Inc. (Nasdaq: DSCI ), ... care, announces that AMNIOEXCEL® and AMNIOMATRIX®, amniotic allografts ... the Premier, Inc. Regenerative Skin Grafting contract portfolio. ... and AMNIOMATRIX® product lines, which continue to be ...
(Date:12/24/2014)... , Dec. 24, 2014  Vermillion, Inc. (Nasdaq: ... gynecologic disease, announced today that the Company closed ... Oracle Investment Management, Jack W. Schuler , ... proceeds were $10.5 million, before offering expenses.  The ...
(Date:12/24/2014)... Boston, MA (PRWEB) December 23, 2014 Earlier ... James L. Sherley, director of the Adult Stem Cell Technology ... overlooked and under appreciated unique property of adult tissue stem ... Misunderstood in the Past, Important for the Future,” embodied the ...
Breaking Biology Technology:El Dr. Paul Janssen Award for Biomedical Research emite su llamada a los nominados para 2015 2El Dr. Paul Janssen Award for Biomedical Research emite su llamada a los nominados para 2015 3El Dr. Paul Janssen Award for Biomedical Research emite su llamada a los nominados para 2015 4Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 2Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 3Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 4Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 5Vermillion Announces Closing of Equity Financing 2Vermillion Announces Closing of Equity Financing 3Adult Stem Cell Technology Center, LLC’s Director Sherley's Address on What’s Holding Back Regenerative Medicine Featured on Omics Group Website 2Adult Stem Cell Technology Center, LLC’s Director Sherley's Address on What’s Holding Back Regenerative Medicine Featured on Omics Group Website 3Adult Stem Cell Technology Center, LLC’s Director Sherley's Address on What’s Holding Back Regenerative Medicine Featured on Omics Group Website 4
... time again for the half-year roundup of stock market results for ... the results from the first quarter, it was pretty dismal for ... Nasdaq National Market down 8 percent , Nasdaq Biotech down 16% ... great trend. As you can see below, the results for the ...
... profound impact on farming much the same as people would ... dot-com businesses, though many might not realize it. , , ... family farm in Loyal, WI, will showcase the latest technology ... on Tuesday, July 12, and runs thru Thursday, July 14. ...
... Crosse, Wis. - Merkle Inc. , has ... a data quality software solution, to modify their data ... customers the ability to customize and aggregate information, cleanse ... and provide association and householding capabilities. Users also have ...
Cached Biology Technology:Midwest large cap life sciences mostly outperform market 2Midwest large cap life sciences mostly outperform market 3Farmers explore technology at Wisconsin event 2
(Date:1/22/2015)... NEW YORK and POINT ROBERTS, Washington ... global news source covering leading sectors including technology and tech ... Personal Privacy marketplace featuring master pickpocket and security consultant ... wallet is stolen and talks about the Wocket™ biometric smart ...
(Date:1/22/2015)... N.C. , Jan. 22, 2015 Infinisource has launched ... of the G2 model. The G2 sets a higher standard ... iSolved human capital management solution. With plug-and-play installation, touch screen ... time clock provides a robust time collection solution for the ...
(Date:12/19/2014)... 18, 2014 Research and Markets ( http://www.researchandmarkets.com/research/8kmfcn/iphone_5s ... 5S Fingerprint Sensor - Apple/AuthenTec TMDR92 & Sapphire - ... http://photos.prnewswire.com/prnh/20130307/600769 Following the ... fingerprint reading feature with the iPhone 5S. It is ...
Breaking Biology News(10 mins):Apollo Robbins Talks about the Illusion of Personal Safety and How Easily Your Wallet is Stolen; If a Wocket Wallet is Stolen the Thief Can't do Anything With it! 2Apollo Robbins Talks about the Illusion of Personal Safety and How Easily Your Wallet is Stolen; If a Wocket Wallet is Stolen the Thief Can't do Anything With it! 3Infinisource's NXG series sets new time clock standard 2iPhone 5S Fingerprint Sensor - Apple/AuthenTec TMDR92 & Sapphire - Technology Report 2
... their existence without thousands of proteins performing myriad vital ... the study of protein structure and function can lead ... disorders. For example, the discovery of insulin’s role in ... treatment based on insulin injections. Yet, despite enormous research ...
... a paper that will be published online in advance of ... and colleagues (The Salk Institute and HHMI) demonstrate that ... as in animals. , "These findings will influence our thinking ... to understand why cells use them as signaling compartments," noted ...
... Center researchers helps explain how “memory” T cells protect ... today in Proceedings of the National Academy of Science ... organs where immune cells reside and proliferate, but also ... spread of an invading virus occurs. , After becoming ...
Cached Biology News:Weizmann Institute scientists develop a general 'control switch' for protein activity 2Weizmann Institute scientists develop a general 'control switch' for protein activity 3How 'memory' T cells curb the spread of viruses throughout the body 2
...
Peptide-affinity Purified Polyclonal Antibody to MAML1 / Mastermind Peptide with sequence VLPTCPMAEFALPR, from N Terminus of the protein sequence according to NP_055572....
Mouse monoclonal [5H9] to RAD52 ( Abpromise for all tested applications). entrezGeneID: 5893 SwissProtID: P43351...
... to the family of calcium binding proteins such ... composed of an alpha and beta chain whereas ... S100 protein is also expressed in the antigen ... skin and interdigitating reticulum cells in the paracortex ...
Biology Products: