Navigation Links
Cancer siRNA Oligo Set Version 1.0

YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
TAG: Cancer siRNA Oligo Set Version

(Date:8/29/2014)... Boston, MA, San Antonio, TX (PRWEB) August 29, ... audited, ISO 9001:2008 and ISO 13485:2003 certified, GAMP® ... it has been awarded an international Phase II ... patients with non-Hodgkin’s lymphoma. , Throughout this trial, ... services including, but not limited to, protocol and ...
(Date:8/28/2014)... A new research platform uses a ... tiny structures undergoing stress and heating, an ... designs for microelectronics and batteries., This new ... about how heating and the surface stress ... Researchers have discussed the merits of surface-stress ...
(Date:8/28/2014)... ATLANTA , Aug. 28, 2014   SunTrust ... of three industry veterans to its equity research ... "Our ongoing expansion in equity research demonstrates ... with unique insights to enhance their investment decision ... Equities at STRH.  "We continue to make significant ...
(Date:8/28/2014)... Vt. (PRWEB) August 28, 2014 ... testing around the world is available from Strategic ... diagnostics companies. “ Industrial Microbiology Market Review, Fourth ... Industrial Market ” (IMMR—4) tracks and compares microbiology ... in North America, Europe and Asia, and forecasts ...
Breaking Biology Technology:Intrinsic Imaging Awarded Phase II Clinical Trial to Assess New Treatment for Non-Hodgkin’s Lymphoma 2New analytical technology reveals 'nanomechanical' surface traits 2New analytical technology reveals 'nanomechanical' surface traits 3SunTrust Robinson Humphrey Expands Equity Research in Healthcare and Energy 2SunTrust Robinson Humphrey Expands Equity Research in Healthcare and Energy 32 Billion Industrial Microbiology Tests Conducted for Product Quality and Safety Worldwide 22 Billion Industrial Microbiology Tests Conducted for Product Quality and Safety Worldwide 3
... in Orlando, I spoke at the well-attended BICSI Conference . ... PEAK 10's data centers to get a first-hand view ... after doing some online research, and I figured I would have ... another article because data centers have become an issue. ...
... Wis. - Citing one-time gains due to Hurricane Katrina ... has reported a net loss of nearly $45 million, ... 2006. , ,The information management services firm reported net income ... the fourth quarter of 2005, a drop of 29.6 percent. ...
... Wis. - AT&T Wisconsin will create 200 ... a new Internet-based video service that soon will be available ... Scott T. VanderSanden, president of AT&T Wisconsin, and Seth Rosen, ... (CWA), said the new jobs will be located at an ...
Cached Biology Technology:Data centers: Blowing smoke and raising red flags 2Data centers: Blowing smoke and raising red flags 3Data centers: Blowing smoke and raising red flags 4Data centers: Blowing smoke and raising red flags 5Data centers: Blowing smoke and raising red flags 6
(Date:8/28/2014)... million kilometres of new roads will be built worldwide ... Earth,s last wildernesses, where they bring an influx of ... an ambitious study has created a ,global roadmap, for ... balance the competing demands of development and environmental protection. ... that estimates that natural importance of ecosystems and a ...
(Date:8/28/2014)... Wally Broeker, the first person to alert the world ... to be captured and stored underground. He says ... emissions, is the best way to avoid global warming ... Professor Broeker (Columbia University, New York) made the call ... Reykjavik, Iceland, where 150 scientists are meeting to discuss ...
(Date:8/28/2014)... at Ludwig-Maximilians-Universitaet (LMU) in Munich have assigned a ... of predatory arthropods. These animals lived in shallow ... related forms found in Jurassic strata. , ... shallow marine habitat and were fossilized some 435 ... denizens of the Silurian seas although they ...
Breaking Biology News(10 mins):Study shows where on the planet new roads should and should not go 2Study shows where on the planet new roads should and should not go 3Global warming pioneer calls for CO2 to be taken from atmosphere and stored underground 2Paleontology: Oldest representative of a weird arthropod group 2
... 2012 According to a ... - By Model / type (two-, three-, ... Healthcare, Government, Defense, Travel & Immigration, Consumer ... (2012 - 2017)", published by MarketsandMarkets ( ), ...
... higher yield than their homozygous parents. Plant breeders have ... this effect called heterosis for richer harvests. Until now, ... phenomenon. Researchers at the University of Bonn and partners ... possible mechanism in corn roots. More genes are active ...
... field work by associate professor James Davis Reimer and two ... in Okinawa, Japan has found two new species of encrusting ... species belong to the genus Neozoanthus , which was ... Ocean. Surprisingly, the new species were found in the Pacific ...
Cached Biology News:Multi-Factor Authentication Market Worth $5.45 Billion by 2017 2Multi-Factor Authentication Market Worth $5.45 Billion by 2017 3Multi-Factor Authentication Market Worth $5.45 Billion by 2017 4Corn: Many active genes - high yield 2Corn: Many active genes - high yield 3An ocean away: 2 new encrusting anemones found in unexpected locations 2
Hybridization Buffer 3.6 ml...
Mouse monoclonal [0.N.305] to G protein alpha - BSA and Azide free ( Abpromise for all tested applications). Antigen: Partially purified G protein alpha from rat brain. Entrez GeneID: 2778 ...
Rabbit polyclonal to hCG ( Abpromise for all tested applications). entrezGeneID: 1081 SwissProtID: P01215...
Glutathione Agarose Beads 10 ml...
Biology Products: