Navigation Links
Cancer siRNA Oligo Set Version 1.0

YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
TAG: Cancer siRNA Oligo Set Version

(Date:9/13/2014)... Boehringer Laboratories Inc., with a forty ... announce the successful broadcast of a live surgery by ... MD, FACS, FAMBS, and Maher El Chaar, MD, FACS, ... , This sleeve gastrectomy surgery was performed and ... four hundred surgeons from around the world during the ...
(Date:9/12/2014)... , Sept. 12, 2014   Arthur Kay ... bio-bean, has won the Postcode Lottery Green Challenge 2014. ... Kay euro 500,000 ($680,000 USD) at the final in ... business plan. Kay,s company uses a ... biofuel products, namely biodiesel and biomass pellets, used for ...
(Date:9/12/2014)... 2014 Research and Markets has ... Photoresist Industry Report 2014" report to their offering. ... Report 2014 is a professional and in-depth study on ... industry . The report provides a basic ... industry chain structure. The dry film photoresist market analysis ...
(Date:9/12/2014)... LONDON , September 12, 2014 ... 4,591.81, up 0.12%, the Dow Jones Industrial Average finished the ... at 1,997.45, up 0.09%. The gains were broad based as ... The S&P 500 Health Care Sector Index ended the day ... in the last one month. Investor-Edge has initiated coverage on ...
Breaking Biology Technology:Boehringer Laboratories, Inc. Announces Live Surgery Using Innovative System to Calibrate Sleeve Gastrectomy 2Green Startup Bio-Bean Wins $680,000 in Postcode Lottery Green Challenge 2Green Startup Bio-Bean Wins $680,000 in Postcode Lottery Green Challenge 3Global Dry Film Photoresist Industry Report 2014 2Technical Coverage on Biotech Stocks - Exelixis, Arena Pharma, Novavax, Dendreon, and Amicus Therapeutics 2Technical Coverage on Biotech Stocks - Exelixis, Arena Pharma, Novavax, Dendreon, and Amicus Therapeutics 3Technical Coverage on Biotech Stocks - Exelixis, Arena Pharma, Novavax, Dendreon, and Amicus Therapeutics 4Technical Coverage on Biotech Stocks - Exelixis, Arena Pharma, Novavax, Dendreon, and Amicus Therapeutics 5
... Australia, January 23, 2012 Ansell Limited ... it has entered into a multi-year agreement with Koreca ... a leading hand protection specialist in Korea. ... Koreca Industries its exclusive distributor of Industrial and New ...
... 23, 2012   BioLife Solutions , Inc. (OTCBB: BLFS), ... hypothermic storage and cryopreservation freeze media ... additional key opinion leaders in the biobanking , ... markets have joined the Company,s Scientific Advisory Board ...
... Scientists at deCODE Genetics and academic ... report the discovery of variants in the human genome ... risk of thyroid cancer.The paper ,Discovery of common variants ... is published today in the online edition of ...
Cached Biology Technology:BioLife Solutions Adds Clinical and Commercialization Experts to Scientific Advisory Board 2BioLife Solutions Adds Clinical and Commercialization Experts to Scientific Advisory Board 3BioLife Solutions Adds Clinical and Commercialization Experts to Scientific Advisory Board 4BioLife Solutions Adds Clinical and Commercialization Experts to Scientific Advisory Board 5deCODE Genetics, in Collaboration with Academic Colleagues, Discovers Three Variants in the Sequence of the Human Genome that Affect the Risk of Thyroid Cancer 2
(Date:9/16/2014)... PALM BEACH GARDENS, Fla. , Sept. 16, ... provider of biometric identity management solutions, announced today ... handheld solution designed to authenticate the identity of ... The Android-based Verifier Sentry rapidly reads ... the credential holder,s ID by matching the biometric ...
(Date:9/15/2014)... 15, 2014) The so-called central dogma of ... long provided a simplified explanation for how genetic ... , In reality, of course, the process ... articulated nearly 60 years ago by Nobel Laureate ... For one, there are multiple types of RNA, ...
(Date:9/15/2014)... single group of microorganisms may be responsible for much ... with implications for the global carbon cycle and climate ... required by most life on this planet, it is ... because it is so large and complex. For humans, ... brain and nervous systems, as well as DNA synthesis ...
Breaking Biology News(10 mins):Cross Match Launches New Identity Management Handheld Solution 2Scientists discover RNA modifications in some unexpected places 2Researchers discover new producer of crucial vitamin 2
... Researchers at Ume Plant Science Center in Sweden discovered, in ... sugar beets that blocks flowering. Only with the cold of ... to blossom in its second year. The discovery of this ... beets bloom. The new findings were recently published in the ...
... consumed, researchers have learned that up to 90 percent ... the drugs can leave the body almost intact through ... areas, excreted antibiotics can then enter stream and river ... animal feeding operations, fish hatcheries, and nonpoint sources such ...
... Rensselaer Polytechnic Institute assistant professor of chemical and biological ... engineers developing exciting and novel new techniques to treat ... disease, Parkinson,s disease, traumatic brain injury, and brain cancer. ... Goldhirsh Foundation and now has garnered the support of ...
Cached Biology News:New discovery about how flowering time of plants can be controlled 2Virginia Tech engineer identifies new concerns for antibiotic resistance, pollution 2Virginia Tech engineer identifies new concerns for antibiotic resistance, pollution 3Delivering drugs to the brain: New research into targeted treatment of Alzheimer's 2Delivering drugs to the brain: New research into targeted treatment of Alzheimer's 3
Rabbit polyclonal to XPC ( Abpromise for all tested applications). Antigen: Synthetic peptide from N-terminus of Human XPC conjugated to a carrier protein Entrez Gene ID: 7508 Swiss ...
Rabbit polyclonal to FANCG ( Abpromise for all tested applications). Antigen: Synthetic peptide: MSRQTTSVGSSC, corresponding to amino acids 1 - 12 of Human FANCG. Entrez GeneID: 2189 Swis...
Rabbit polyclonal to DcR2 ( Abpromise for all tested applications). entrezGeneID: 8793 SwissProtID: Q9UBN6...
Biology Products: