Navigation Links
Cancer siRNA Oligo Set Version 1.0

TIAM1
TLX1
TNFRSF1B
TNFRSF6 TP53
VAV1
VHL
WNT1
WNT2
WNT5A
WNT7B
WT1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
symbol
Accession # Unigene Target
location
Coding
region
siRNA target %GC
ABCB1
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52

'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Cancer siRNA Oligo Set Version

(Date:12/15/2014)... -- GlassesOff Inc. (OTCBB: GLSO) announced today the appointment of ... of the Company,s Board of Directors. Mr. ... CEO until its acquisition by Stanley Black ... as the inventor of the first Wi-Fi-based Active RFID ... RFID solutions focused on improving operational efficiency, safety and ...
(Date:12/13/2014)... Dec. 12, 2014 /CNW/ - MaRS and Virgin Unite Canada, ... they have joined forces to support Canadian entrepreneurs tackling social ... Group Founder was at the MaRS Centre to announce the ... impact venture fund. This fund has $1 million in seed ... Vancouver -based Mindset Social Innovation Foundation, founded by ...
(Date:12/13/2014)... 2014 The “Global Synthetic Biology ... drivers, threats, opportunities, and challenges. , The global ... players, namely, Thermo Fisher Scientific, Inc. (U.S.), DuPont ... jointly accounted for approximately ~65% of the total ... Copy for This Report @ http://www.marketsandmarkets.com/Market-Reports/synthetic-biology-market-889.html ...
(Date:12/13/2014)... 2014 Research and Markets ( ... "Glucose Sensors: the Next Generation" report ... http://photos.prnewswire.com/prnh/20130307/600769 The convergence of small-scale ... hope for a better future to millions of ... measure glucose levels accurately and reliably have the ...
Breaking Biology Technology:AeroScout Founder Joins GlassesOff's Board of Directors 2AeroScout Founder Joins GlassesOff's Board of Directors 3MaRS and Virgin Unite partner to invest in business as a force for good 2MaRS and Virgin Unite partner to invest in business as a force for good 3Synthetic Biology Market to HIt $5.6304 Billion by 2018 - New Research Report by MarketsandMakets 2Synthetic Biology Market to HIt $5.6304 Billion by 2018 - New Research Report by MarketsandMakets 3Glucose Sensors: the Next Generation 2Glucose Sensors: the Next Generation 3
... , ... assay • LEADseeker • SPA Imaging Beads, ... present in high levels in the pituitary and are processed into ... and β-endorphin. The various melanocyte stimulating hormones are known to activate ...
... , ... kinase assay • LEADseeker • chemiluminescence , , ... least 500 kinase and phosphatase enzymes exist, their activities having ... cascade in disease pathways such as inflammation and cancer, so ...
... , ... workspace • base set • differential expression analysis • principal components ... , ... advanced statistics on samples from a study on human ovarian cancer. ...
Cached Biology Technology:The development of a melanocortin MC4 receptor binding assay using the LEADseeker Multimodality Imaging System 2The development of a melanocortin MC4 receptor binding assay using the LEADseeker Multimodality Imaging System 3The development of a melanocortin MC4 receptor binding assay using the LEADseeker Multimodality Imaging System 4The development of a melanocortin MC4 receptor binding assay using the LEADseeker Multimodality Imaging System 5Performance of the AMARA HitHunter Chemiluminescence Kinase Assay with the LEADseeker Multimodality Imaging System 2Performance of the AMARA HitHunter Chemiluminescence Kinase Assay with the LEADseeker Multimodality Imaging System 3Performance of the AMARA HitHunter Chemiluminescence Kinase Assay with the LEADseeker Multimodality Imaging System 4Extended data analysis using DeCyder EDA 2Extended data analysis using DeCyder EDA 3Extended data analysis using DeCyder EDA 4Extended data analysis using DeCyder EDA 5Extended data analysis using DeCyder EDA 6Extended data analysis using DeCyder EDA 7Extended data analysis using DeCyder EDA 8Extended data analysis using DeCyder EDA 9Extended data analysis using DeCyder EDA 10
(Date:11/21/2014)... , November 18, 2014 According ... Market by Systems (Video, RFID, Access Control, Intrusion Detection, ... Hotels, Banks, Government), Component Service Geography - Global Forecasts ... Market is projected to be around $25 Billion in ... 2020, growing at a CAGR of 8.69%. ...
(Date:11/18/2014)...  The Secure Identity & Biometrics Association (SIBA) ... the formation of The Airport Entry and Exit ... and Biometric Entry and Exit Solutions Framework for ... from BORDERPOL, the international non-profit organization that works ... regarding border security, traveler and migration systems. ...
(Date:11/12/2014)... 2014 Crossmatch™, a leading provider of biometric ... fingerprint readers have been deployed throughout Montparnasse Pasteleria, ... Mexico . The bakery chain implemented the Crossmatch ... caused by employees clocking in for each other. ... Montparnasse relied on paper timecards and a mechanical time ...
Breaking Biology News(10 mins):Industrial Security Systems Market Worth $38 Billion by 2020 2Industrial Security Systems Market Worth $38 Billion by 2020 3Identity Management, Document Authentication and Biometric Companies Form "The Airport Entry and Exit Working Group", Releasing the Framework to Help Guide the Department of Homeland Security and Congress Towards Solutions 2Identity Management, Document Authentication and Biometric Companies Form "The Airport Entry and Exit Working Group", Releasing the Framework to Help Guide the Department of Homeland Security and Congress Towards Solutions 3Montparnasse Pasteleria Achieves Time and Attendance Transparency with Crossmatch U.are.U Fingerprint Readers 2
... University of Pennsylvania researchers has revealed that a number of ... to represent three different species are all members of ... led other scientists to label them as separate species in ... the study found. "Because of the vagaries of ...
... CAMBRIDGE, Mass. -- By tracking the previously unknown movements ... are shedding new light on how the immune system ... Central to the immune response is the activity ... in the body,s lymph nodes upon detection of a ...
... August 9, 2013 Felle competitie en ... en efficiënter de beste kandidaten te matchen. Voor bedrijven ... moderne arbeidsmarkt komt CRMATCH met een geavanceerde oplossing gebaseerd ... recruiter worstelt met alsmaar grotere en complexere hoeveelheden gegevens. ...
Cached Biology News:Fresh analysis of dinosaur skulls by penn researchers finds 3 species are 1 2Fresh analysis of dinosaur skulls by penn researchers finds 3 species are 1 3Helper cells aptly named in battle with invading pathogens 2Recruiters matchen het efficiëntst met CRMATCH en ELISE 2
... sequence alignment, 3D structure visualization, phylogenetic tree ... in a single application. ... Uniprot, sort and filter them in real-time ... it, rapidly searching, filtering and sorting ...
...
Request Info...
...
Biology Products: