Navigation Links
Cancer siRNA Oligo Set Version 1.0

YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
TAG: Cancer siRNA Oligo Set Version

(Date:7/30/2015)... , July 30, 2015   Aratana ... pet therapeutics company focused on the licensing, development ... animals, today announced that its strategic partner VetStem ... dose confirmation study of AT-016, an adipose-derived allogeneic ... the treatment of osteoarthritis pain in dogs. ...
(Date:7/30/2015)... Denmark , July 30, 2015 ... biotechnology company that applies its innovative TransCon technology ... positive top-line results from a six-month Phase 2 ... once-weekly TransCon Growth Hormone in 53 treatment-naïve, pre-pubertal ... "We are extremely pleased with the top-line ...
(Date:7/30/2015)... ... 2015 , ... As part of its 2015 growth plan and as a follow up to ... business units, Whitehouse Laboratories is pleased to announce that it has begun construction on a ... Excellence and will be strictly dedicated to basic USP 51, USP 61, and USP 62 ...
(Date:7/29/2015)... 30, 2015 Sanofi, un ... ses résultats pour le premier semestre 2015. Le ... résultats. Visionner l,interview vidéo et lire ... Au sommaire de l,interview :  ... de croissance - Diabète ...
Breaking Biology Technology:Aratana Therapeutics Announces Positive Pilot Field Study for AT-016 2Aratana Therapeutics Announces Positive Pilot Field Study for AT-016 3Aratana Therapeutics Announces Positive Pilot Field Study for AT-016 4Aratana Therapeutics Announces Positive Pilot Field Study for AT-016 5Ascendis Pharma A/S Announces Positive Top-line Results from a Phase 2 Pediatric Study of Once-Weekly TransCon Growth Hormone for the Treatment of Growth Hormone Deficiency 2Ascendis Pharma A/S Announces Positive Top-line Results from a Phase 2 Pediatric Study of Once-Weekly TransCon Growth Hormone for the Treatment of Growth Hormone Deficiency 3Ascendis Pharma A/S Announces Positive Top-line Results from a Phase 2 Pediatric Study of Once-Weekly TransCon Growth Hormone for the Treatment of Growth Hormone Deficiency 4Ascendis Pharma A/S Announces Positive Top-line Results from a Phase 2 Pediatric Study of Once-Weekly TransCon Growth Hormone for the Treatment of Growth Hormone Deficiency 5Ascendis Pharma A/S Announces Positive Top-line Results from a Phase 2 Pediatric Study of Once-Weekly TransCon Growth Hormone for the Treatment of Growth Hormone Deficiency 6Ascendis Pharma A/S Announces Positive Top-line Results from a Phase 2 Pediatric Study of Once-Weekly TransCon Growth Hormone for the Treatment of Growth Hormone Deficiency 7Whitehouse Labs Formally Announces Plans to Open a Microbiological Laboratory 2
... adept at climbing through difficult terrain using an intricate adhesive ... how they switch on their unique system of traction. ... South Carolina have discovered that the geckos, amazing grip is ... adhesive research will be published Wed., Aug. 5, at 00:001 ...
... , , SOUTH SAN ... PARD ), a biopharmaceutical company focused on oncology, today reported financial ... a corporate update. , , "During the ... 2 picoplatin data from our colorectal and prostate cancer programs. ...
... NEW YORK, Aug. 4 Keryx Biopharmaceuticals, Inc. (Nasdaq: KERX ... 8:30 a.m. EDT to discuss the second quarter 2009 financial results and ... Officer of the Company, will host the call. Keryx will announce ... issued prior to the call. , , In order ...
Cached Biology Technology:New angle on gecko research 2Poniard Pharmaceuticals Reports Second Quarter 2009 Financial Results and Provides a Corporate Update 2Poniard Pharmaceuticals Reports Second Quarter 2009 Financial Results and Provides a Corporate Update 3Poniard Pharmaceuticals Reports Second Quarter 2009 Financial Results and Provides a Corporate Update 4Poniard Pharmaceuticals Reports Second Quarter 2009 Financial Results and Provides a Corporate Update 5Poniard Pharmaceuticals Reports Second Quarter 2009 Financial Results and Provides a Corporate Update 6Poniard Pharmaceuticals Reports Second Quarter 2009 Financial Results and Provides a Corporate Update 7Poniard Pharmaceuticals Reports Second Quarter 2009 Financial Results and Provides a Corporate Update 8Keryx Biopharmaceuticals, Inc. to Hold Conference Call on Second Quarter 2009 Financial Results on Thursday, August 6, 2009 at 8:30am EDT 2
(Date:7/20/2015)...  Acuity Market Intelligence,s latest research "The Global ... and Privacy" forecasts that between 2014 and 2020 ... downloaded to smart mobile devices by 2.2 billion ... projected to generate more than $67.9 billion in ... period.    "Biometrics is at the ...
(Date:7/9/2015)... July 9, 2015  Synaptics Inc. (NASDAQ: SYNA ), ... that it will report financial results for the fourth ... 2015 after the close of market. The company will ... at 2:00 p.m. PT (5:00 p.m. ET), during which ... participate on the live call, analysts and investors should ...
(Date:7/9/2015)... JOSE, Calif. , July 9, 2015 ... the leading developer of human interface solutions, ... technology, the industry,s first fully hardware encapsulated ... Match-in-Sensor secure authentication technology is literally off ... storage and biometric matching within the fingerprint ...
Breaking Biology News(10 mins):Biometrics on Smart Mobile Devices to Redefine Digital Identity with 12.9 Billion Biometric App Downloads between 2014 and 2020 2Synaptics to Report Fourth Quarter, Fiscal Year 2015 Results on July 30 2Synaptics Announces World's First Match-in-Sensor Fingerprint Authentication Technology 2Synaptics Announces World's First Match-in-Sensor Fingerprint Authentication Technology 3
... humans: pubic lice, Pthirus pubis , and human head ... in BioMed Central,s open access Journal of Biology ... In the article, Robert Weiss from University ... pondering the question of why lice would separate into two ...
... In a fight against respiratory infections, the body typically ... productive cough. But new research suggests that the influenza virus ... lungs, interfering with the supply of oxygen to the rest ... to eliminate the virus, but this research suggests that it,s ...
... The genome of a marine bacterium living 2,500 meters ... life adapts in extreme thermal and chemical gradients, according ... PLoS Genetics , an open-access publication published by ... on the bacterium Nautilia profundicola , a microbe ...
Cached Biology News:Study: Fluid buildup in lungs is part of the damage done by the flu 2Study: Fluid buildup in lungs is part of the damage done by the flu 3Genetic adaptations key to microbe's survival in challenging environment 2
... to rapidly and reliably amplify unknown genomic ... APAgene provides hassle-free, ready-to use components, at ... are provided in each kit. The Genome ... filling, localized cloning of genomic DNA, isolating ...
Rabbit polyclonal to Quinaldic Acid ( Abpromise for all tested applications). Antigen: Synthetic peptide Quinaldic Acid conjugated to a protein carrier....
Mol wt: average mol wt16,951.27 Da by calculation...
A set of five peptides which can be used to calibrate a Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) or Electrospray Ionization (ESI) mass spectrometer....
Biology Products: