Navigation Links
Cancer siRNA Oligo Set Version 1.0

YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
TAG: Cancer siRNA Oligo Set Version

(Date:8/1/2014)... This is a professional and in-depth study on ... Global and China. The report provides a basic overview ... structure. Global market analysis and Chinese domestic market analysis ... and competitive landscape of the market. A comparison between ... The report also focuses on development policies and plans ...
(Date:8/1/2014)... 1. 2014 As one of the 10 ... Annual Meeting & Clinical Lab Expo is the place ... are introduced to the healthcare world. This year, many ... exhibitors will include the latest diagnostic technology in the ... smartphones and biosensors have enabled the development of "labs-on-a-chip" ...
(Date:8/1/2014)... , Aug. 1, 2014 The  PROPEL Center ... number and success rate of early-stage life sciences companies ... it has awarded 15 grants to help ... The MedTech Conference   in Chicago ... conference in North America , bringing ...
(Date:8/1/2014)... 01, 2014 Once a decision has ... This webinar will discuss how to define your tolerance ... speakers Bob Allen, Senior Director of Facilities Integration at ... at Fluor Industrial Services, and special guest Carrier Li, ... at Amgen, as they provide an examination of the ...
Breaking Biology Technology:Ammonium Bicarbonate Market in Internations & Chinese Regions Research Analysis Now Available at 2Ammonium Bicarbonate Market in Internations & Chinese Regions Research Analysis Now Available at 3Lab-on-a-Chip Technology to Be Featured at 2014 AACC Annual Meeting & Clinical Lab Expo 2Lab-on-a-Chip Technology to Be Featured at 2014 AACC Annual Meeting & Clinical Lab Expo 3iBIO Institute's PROPEL Center Awards Grants for AdvaMed 2014 to Early-Stage Life Sciences Companies 2iBIO Institute's PROPEL Center Awards Grants for AdvaMed 2014 to Early-Stage Life Sciences Companies 3iBIO Institute's PROPEL Center Awards Grants for AdvaMed 2014 to Early-Stage Life Sciences Companies 4Defining Low Cost in Your Solution for Future Facilities, New Webinar for Pharma, Biotech, Medical Device and Healthcare Companies, Hosted by Xtalks 2
... Chinmax Medical Systems Inc., a leading cardiac biomarker distributor ... its lawsuit against Inverness Medical Beijing (IMB), a subsidiary ... the Complaint, Inverness Medical Beijing secretly imported massive quantities ... customers during the period when Chinmax retained the undisputed ...
... April 11, 2011 Leading experts from around the world ... the 6th Canine Vector Borne Disease (CVBD) forum in Nice, ... to animals and humans by these increasingly important diseases. ... and even death in dogs, and many CVBDs represent a ...
... MabVax Therapeutics, Inc., a privately held clinical stage ... antibody based therapies to address the unmet medical need ... the Phase 2 portion of the Small Business Innovation ... under the agency,s Streamlined Non-competing Award Procedures (SNAP). The ...
Cached Biology Technology:Beijing Chaoyang District Court Grants Investigation Letters Against Inverness Medical Beijing, A Subsidiary of Alere Inc. 2Veterinarians and Pet Owners Urged to Act Upon Evolving Dangers Posed by CVBDs as New Research Underlines Threats to Animals and Humans 2Veterinarians and Pet Owners Urged to Act Upon Evolving Dangers Posed by CVBDs as New Research Underlines Threats to Animals and Humans 3Veterinarians and Pet Owners Urged to Act Upon Evolving Dangers Posed by CVBDs as New Research Underlines Threats to Animals and Humans 4MabVax Therapeutics Receives $1.8 Million in a Phase 2 Small Business Innovation Research Program Award From the National Cancer Institute 2MabVax Therapeutics Receives $1.8 Million in a Phase 2 Small Business Innovation Research Program Award From the National Cancer Institute 3
(Date:7/31/2014)... ago, prestin was found to be a key gene responsible ... in the hair cells of the inner ear that contracts ... like an antique phonograph horn, amplify sound waves to make ... published in the advanced online edition of Molecular Biology ... prestin has also independently evolved to play a critical role ...
(Date:7/31/2014)... the largest minority group in the United States, comprising ... are obese and are 1.2 times as likely to ... College of Nursing student researcher Lauren Gerchow, BSN, RN, ... contribute to this problem by compiling a systematic review ... Latina women recently published in Nursing Research . ...
(Date:7/31/2014)... of the roughly 156,000 gas stations across the ... parts of underground gas storage tankscorrosion that could ... a source of drinking water. In recent years, ... rapidly corroding gas storage tank components such as ... use of gasoline-ethanol blends and the presence of ...
Breaking Biology News(10 mins):NYU research looks to combat US Latina immigrant obesity 2NIST corrosion lab tests suggest need for underground gas tank retrofits 2
... Wisconsin research team, led by John W. Lough, Ph.D., professor ... stem cells (ES cells) in animals can be cultivated to ... to replace tissue damaged as a result of a heart ... or diseased cells in adult tissues has caused extraordinary interest ...
... Durham, N.C. ?A new understanding of the causes for symptoms ... 600 African-Americans, has resulted from a study by researchers at ... Their findings may lead to a new, more direct method ... that an inability of red blood cells to relax blood ...
... each year worldwide, causing one million deaths. Around 90% ... children. One of the greatest challenges facing Africa in ... chloroquine (CQ), the cheapest and most widely used antimalarial, ... the first-developed and least expensive alternative to CQ, is ...
Cached Biology News:Stem Cell Research Shows Potential for Replacing Tissue Damaged in Heart Attacks 2Discovery Promises Simpler Therapy for Sickle Cell Disease 2Discovery Promises Simpler Therapy for Sickle Cell Disease 3Reducing malarial transmission in Africa 2
... Thermo has established an expertise in ... both for solid support synthesis and synthesis ... controlled by Mass Spectrometry and analytical HPLC ... provide products that meet the highest quality ...
The Wellwash 4 Mk 2 microplate washer combines flexibility, simplicity and ease of use. This reliable microplate washer meets the exacting standards of today's ELISA assay requirements....
... These handy dispensers save space and ... and other garb. They are the ... parts used in labs, processing and ... charges and the particles they attract. ...
... dispensers save space and organize ... and other garb. They are ... for small parts used in ... acrylic. Many other sizes and ...
Biology Products: