Navigation Links
Cancer siRNA Oligo Set Version 1.0

TIAM1
TLX1
TNFRSF1B
TNFRSF6 TP53
VAV1
VHL
WNT1
WNT2
WNT5A
WNT7B
WT1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
symbol
Accession # Unigene Target
location
Coding
region
siRNA target %GC
ABCB1
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52

'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Cancer siRNA Oligo Set Version

(Date:6/30/2015)... 2015 /PRNewswire/ - Resverlogix Corp. ("Resverlogix") (TSX:RVX) announced ... Resverlogix have approved the resolutions relating to: (i) ... 5,600,000 units at a price of $2.67 per ... comprised of one common share and 0.075358 common ... CAD$15 million; and (ii) the amendment to Resverlogix,s ...
(Date:6/30/2015)... ... June 30, 2015 , ... uBiome and OpenBiome Partner ... mechanics of fecal microbiota transplantation in C. difficile patients. , SAN FRANCISCO, uBiome ... undergoing fecal microbiota transplantation (FMT) as a treatment for Clostridium difficile infections (C. ...
(Date:6/30/2015)... , June 30, 2015  The University of ... Biosciences (CCE/Bio) and UC San Diego Extension announced ... be held Aug.  12 – 14, 2015, at ... three-day workshop provides an intense exposure to best ... and is well-suited to biologists, process engineers and ...
(Date:6/30/2015)... (PRWEB) , ... June 30, 2015 , ... ... prior to launching SmartArch — a revolutionary new archwire that allows orthodontists to ... further clinical evidence of the efficacy of SmartArch. “We’re thrilled about taking SmartArch ...
Breaking Biology Technology:Resverlogix Corp. Shareholders Approve Matters Relating to Licensing and Equity Arrangement 2Resverlogix Corp. Shareholders Approve Matters Relating to Licensing and Equity Arrangement 3uBiome and OpenBiome Partner for Microbiome Study in FMT Patients 2uBiome and OpenBiome Partner for Microbiome Study in FMT Patients 3UC San Diego Extension to Offer Third Annual Microbial Fermentation Workshop 2New case studies for SmartArch orthodontic archwire paves way to product launch later this year 2
... , - Microplasmin Shows Clear Promise in ... Macular Hole Closure and Traction Release,Without Need for ... biotechnology company,focused on vascular and eye diseases, will ... trial at the American Society of Retina Specialists,(ASRS) ...
... A preliminary design review has concluded and verified the ... Element on NASAs James Webb Space Telescope. , The ... the Webb Observatory. The telescope consists of a 6.5-meter ... mirrors; and supporting structures, deployable tower and control electronics. ...
... high blood pressure(1); increase in pediatric cases linked to growing ... ... safety profile in adults with high blood pressure, EAST HANOVER, N.J., ... approved following a priority,review by the U.S. Food and Drug Administration (FDA) ...
Cached Biology Technology:ThromboGenics Presents Results of the Vitreomacular Traction Trial (MIVI IIT) at the American Society of Retina Specialists Annual Meeting 2ThromboGenics Presents Results of the Vitreomacular Traction Trial (MIVI IIT) at the American Society of Retina Specialists Annual Meeting 3ThromboGenics Presents Results of the Vitreomacular Traction Trial (MIVI IIT) at the American Society of Retina Specialists Annual Meeting 4James Webb Space Telescope marks successful completion 2FDA Approves Diovan(R) for Treatment of High Blood Pressure in Children 2FDA Approves Diovan(R) for Treatment of High Blood Pressure in Children 3FDA Approves Diovan(R) for Treatment of High Blood Pressure in Children 4FDA Approves Diovan(R) for Treatment of High Blood Pressure in Children 5
(Date:6/16/2015)... /CNW Telbec/ - handyem Inc. and FlowMetric Diagnostics ... of handyem,s HPC-150 portable flow cytometer within FlowMetric ... unprecedented model of mobile laboratory platform is presented ... Pennsylvania Convention Center, ... to 18 th 2015.  By virtue of ...
(Date:6/15/2015)... -- According to a new market research ... and Hybrid), Technologies (Recognition, IVR, OCR, Pattern & Image ... The Natural Language Processing Market is expected to grow ... the forecast period 2015-2020. Browse 65 ... spread   through 155 P ages and in-depth ...
(Date:6/11/2015)... RESTON, Va. , June 11, 2015 /PRNewswire/ ... authentication technology, announced today that its IdentityX Mobile ... FIDO (Fast IDentity Online) Alliance is an industry ... with open standards for simpler, stronger authentication.  In ... services must pass a rigorous series of tests ...
Breaking Biology News(10 mins):handyem and FlowMetric Diagnostics announce their partnership in the development of Flow Cytometry- Based Solutions in diagnostic capabilities 2handyem and FlowMetric Diagnostics announce their partnership in the development of Flow Cytometry- Based Solutions in diagnostic capabilities 3Natural Language Processing Market Worth $13.4 Billion by 2020 2Natural Language Processing Market Worth $13.4 Billion by 2020 3Natural Language Processing Market Worth $13.4 Billion by 2020 4Natural Language Processing Market Worth $13.4 Billion by 2020 5Daon's IdentityX Mobile Authentication Platform One of First Products to be Certified by FIDO Alliance 2
... Conservation Biology Institute and George Mason University broke ... that embodies the concept of the living classroom. ... Program has trained future conservationists with an interdisciplinary ... National Zoological Park,s 3,200-acre facility in Front Royal, ...
... MDAs strange as it sounds, a new research study ... ), suggests that the "healthy" ingredient in red wine, ... sedentary lifestyles have on people. The report describes experiments ... which the group fed resveratrol did not develop insulin ...
... song from a bird of the same species, a zebra finch ... a time, occasionally cocking its head but otherwise immobile. Once it ... routine. ( See video .) In a new study ... ribonucleic acid that appear to regulate protein production go up ...
Cached Biology News:Smithsonian Conservation Biology Institute and George Mason University expand partnership 2MicroRNAs in the songbird brain respond to new songs 2
Agarose for baculovirus plaque assays which allow optimal growth of plated insect cells....
BD BaculoGold Max-XP Insect Cell Medium 1 Liter...
Mycoplasma and virus tested...
Edited by I.H. Pawlowitzki, J.H. Edwards and E.A. Thompson (1997) • This volume covers: Linkage in dominant recessive and oligogenic disease, Model free (non-parametric) methods, Tools for gene ...
Biology Products: