Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:8/11/2017)... ... 2017 , ... “There is an increasing consumer call for ... ingredients,” said Matt Hundt, President of Third Wave Bioactives. “Combining the strong discovery ... of Biorigin will allow us to bring truly novel fermented ingredient technologies to ...
(Date:8/10/2017)... ... August 09, 2017 , ... ... in the clinic is here. The team at Capricor Therapeutics, Inc. utilized a ... for clinical studies. , Dr. Travis Antes, head of analytical development at ...
(Date:8/10/2017)... ... August 09, 2017 , ... ... international biomedical optics laboratories — the Wellman Center for Photomedicine, the Manstein Lab ... Lübeck and the Beckman Laser Institute at University of California, Irvine — and ...
(Date:8/10/2017)... FL (PRWEB) , ... August 10, 2017 , ... ... that the stock market news outlet had initiated coverage on Next Group Holdings, ... growing and underserved consumer markets geared toward those that cannot engage in traditional ...
Breaking Biology Technology:
(Date:4/13/2017)... 13, 2017 According to a new market research ... Analytics, Identity Administration, and Authorization), Service, Authentication Type, Deployment Mode, Vertical, and ... is expected to grow from USD 14.30 Billion in 2017 to USD ... 17.3%. ... MarketsandMarkets Logo ...
(Date:4/11/2017)... -- Research and Markets has announced the addition of ... offering. ... market to grow at a CAGR of 30.37% during the period ... has been prepared based on an in-depth market analysis with inputs ... growth prospects over the coming years. The report also includes a ...
(Date:4/11/2017)... NXT-ID, Inc. (NASDAQ:   NXTD ) ... appointment of independent Directors Mr. Robin D. Richards ... Directors, furthering the company,s corporate governance and expertise. ... Gino Pereira , Chief Executive ... their guidance and benefiting from their considerable expertise as we ...
Breaking Biology News(10 mins):