Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:12/2/2016)... ... , ... DrugDev believes the only way to achieve real change ... three tenets were on display at the 2nd Annual DrugDev User Summit (hosted by ... and site organizations to discuss innovation and the future of clinical research. , ...
(Date:12/2/2016)... ... December 02, 2016 , ... Robots will storm the Prudential Center in Boston, ... The event, which is held on the United Nations International Day of Persons with ... into the workplace. Suitable Technologies is partnering with NTI to showcase how technology can ...
(Date:12/2/2016)... leader in rapid infectious disease tests, introduced the Company,s newest product, the INSTI HIV ... ) Continue Reading ... ... , bioLytical was invited by the Clinton Health ... Self Test to 350 pharmacy representatives in Nairobi and Mombasa, ...
(Date:11/30/2016)... , November 30, 2016 ... a few players hold a dominant share in the ... River Laboratories International, Inc., and Merck KGaA, held a ... 2015. Transparency Market Research observes that these companies are ... on development products that are do not require rabbit ...
Breaking Biology Technology:
(Date:11/30/2016)... CHICAGO , Nov. 30, 2016  higi ... a new partnership initiative targeting national brands, industry ... and reward their respective audiences for taking steps ... Since its inception in 2012, higi has built ... US, impacting over 38 million people who have ...
(Date:11/24/2016)... -- Cercacor today introduced Ember TM Sport Premium ... measure hemoglobin, Oxygen Content, Oxygen Saturation, Perfusion Index, ... approximately 30 seconds. Smaller than a smartphone, using only ... key data about their bodies to help monitor these ... Hemoglobin carries oxygen to muscles. When hemoglobin and ...
(Date:11/17/2016)... Nov. 17, 2016 Global Market Watch: ... (Disease-Based Banks, Population-Based Banks and Academics) market is to witness ... Private Biobanks shows the highest Compounded Annual Growth Rate (CAGR) ... region during the analysis period 2014-2020. North America ... 9.95% followed by Europe at 9.56% ...
Breaking Biology News(10 mins):