Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:6/24/2016)... NC (PRWEB) , ... June 24, 2016 , ... Researchers ... the most commonly-identified miRNAs in people with peritoneal or pleural mesothelioma. Their findings are ... to read it now. , Diagnostic biomarkers are signposts in the blood, lung ...
(Date:6/23/2016)... , June 23, 2016 A person commits a ... crime scene to track the criminal down. An ... Food and Drug Administration (FDA) uses DNA evidence to track ... Sound far-fetched? It,s not. The FDA has increasingly ... support investigations of foodborne illnesses. Put as simply as possible, ...
(Date:6/23/2016)... 2016   EpiBiome , a precision microbiome engineering ... debt financing from Silicon Valley Bank (SVB). The financing ... advance its drug development efforts, as well as purchase ... "SVB has been an incredible strategic partner to us ... bank would provide," said Dr. Aeron Tynes Hammack ...
(Date:6/23/2016)... 2016  Blueprint Bio, a company dedicated to identifying, ... community, has closed its Series A funding round, according ... "We have received a commitment from Forentis Fund ... to meet our current goals," stated Matthew Nunez ... to complete validation on the current projects in our ...
Breaking Biology Technology:
(Date:3/31/2016)...   LegacyXChange, Inc. ... LegacyXChange is excited to release its first ... be launched online site for trading 100% guaranteed authentic ... also provide potential shareholders a sense of the value ... industry that is notorious for fraud. The video is ...
(Date:3/23/2016)... , March 23, 2016 ... erhöhter Sicherheit Gesichts- und Stimmerkennung mit Passwörtern ... (NASDAQ: MESG ), ein führender ... das Unternehmen mit SpeechPro zusammenarbeitet, um erstmals ... Finanzdienstleistungsbranche, wird die Möglichkeit angeboten, im Rahmen ...
(Date:3/21/2016)... 2016 Unique technology combines ... superior security   Xura, Inc. ... secure digital communications services, today announced it is working ... enterprise customers, particularly those in the Financial Services Sector, ... authentication within a mobile app, alongside, and in combination ...
Breaking Biology News(10 mins):