Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:1/18/2017)... ... ... Executive search firm Slone Partners proudly supports the SCOPE ... of the clinical trials segment. Hosted in Miami, this conference brings together renowned ... , As executive talent specialists in the industries central to clinical trials, ...
(Date:1/18/2017)... ... January 18, 2017 , ... Researchers from a new study are stating ... low enough after prostate cancer treatment, this indicates there is still remaining prostate cancer cells ... , “ The PSA test has always been an indicator of whether a man’s prostate ...
(Date:1/18/2017)... 18, 2017 Shareholder rights law firm Johnson ... the board members of CoLucid Pharmaceuticals, Inc. (NASDAQ: ... with the proposed sale of the Company to Eli ... develops small molecules for the acute treatment of migraines. ... had signed a definitive merger agreement with Eli Lilly. ...
(Date:1/17/2017)... ... January 17, 2017 , ... ... Rheumatoid Factor (RF) to its VALIDATE® SP2 calibration verification / linearity test kit. ... human serum base. Each VALIDATE® SP2 kit is prepared using the CLSI recommended ...
Breaking Biology Technology:
(Date:1/11/2017)... 2017  Michael Johnson, co-founder of Visikol Inc. a company originally ... been named to the elite "Forbes 30 Under 30" list in ... people in 20 fields nationwide to be recognized as a leader ... were selected. ... is currently a PhD candidate at Rutgers University. ...
(Date:1/4/2017)... Jan. 4, 2017  For the thousands of attendees at this year,s ... in connected health and biometric measurement devices and services, will be featuring ... On display in A&D Medical,s special CES Exhibit Suite , the ... expansion of the company,s WellnessConnected product platform.  ... ...
(Date:12/22/2016)... 2016 SuperCom (NASDAQ:   ... the e-Government, Public Safety, HealthCare, and Finance sectors announced today that ... selected to implement and deploy a community-based supportive services program to ... , further expanding its presence in the state. ... This new program, which is ...
Breaking Biology News(10 mins):