Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:10/12/2017)... ... October 12, 2017 , ... RPS ... clinical study that demonstrates the accuracy of the FebriDx® test, a commercially-ready, ... acute bacterial and viral respiratory tract infections by testing the body’s immune ...
(Date:10/11/2017)... ... October 11, 2017 , ... ... Andi Purple announced Dr. Suneel I. Sheikh, the co-founder, CEO and chief research ... Inc. has been selected for membership in ARCS Alumni Hall of Fame ...
(Date:10/11/2017)... ... October 11, 2017 , ... Proscia ... be hosting a Webinar titled, “Pathology is going digital. Is your lab ready?” ... pathology adoption best practices and how Proscia improves lab economics and realizes an ...
(Date:10/11/2017)... , ... October 11, 2017 , ... ... the implantation and pregnancy rates in frozen and fresh in vitro fertilization ... progesterone and maternal age to IVF success. , After comparing the results from ...
Breaking Biology Technology:
(Date:5/23/2017)... Italy , May 23, 2017  Hunova, the first robotic gym ... trunk, has been officially launched in Genoa, Italy . ... Europe and the USA . The technology ... on the market by the IIT spin-off Movendo Technology thanks to a ... the Multimedia News Release, please click: ...
(Date:4/24/2017)... Janice Kephart , former 9/11 ... Partners, LLP (IdSP) , today issues the following ... March 6, 2017 Executive Order: Protecting the ... be instilled with greater confidence, enabling the reactivation ... applications are suspended by until at least July ...
(Date:4/13/2017)... UBM,s Advanced Design and Manufacturing event in ... and evolving technology through its 3D Printing and Smart ... the expo portion of the event and feature a ... on trending topics within 3D printing and smart manufacturing. ... will take place June 13-15, 2017 at the Jacob K. ...
Breaking Biology News(10 mins):