Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:2/16/2017)... , Feb. 16, 2017  MDNA Life Sciences ... development of liquid biopsy tests based on the ... an exclusive license agreement with its first international ... liquid biopsy test for prostate cancer, the Prostate ... . This is the first overseas appointment ...
(Date:2/16/2017)... February 16, 2017 Patient ... of innovative telemedicine application, new and leading edge ... experiencing a boom worldwide. The healthcare sector as ... technologies, services and new therapies for companies such ... RHT), Cellectar Biosciences, Inc. (NASDAQ: CLRB ...
(Date:2/16/2017)... , Feb. 16, 2017  Windtree Therapeutics, ... company focusing on developing aerosolized KL4 surfactant therapies ... a preclinical influenza study showed that aerosolized KL4 ... in a well-established preclinical animal model. The Company ... growing body of evidence that supports the role ...
(Date:2/15/2017)... ... 2017 , ... Park Systems , a leader in Atomic Force Microscopy ... drastically boosts productivity with single click reliable nanoscale images, is now available on Park ... and taking the image once done manually by the operator producing high quality nanoscale ...
Breaking Biology Technology:
(Date:2/10/2017)... Research and Markets has announced the addition ... and Commercial Aspects" to their offering. ... Biomarkers play an ... for selection of treatment as well for monitoring the results. ... in modern medicine. Biochip/microarray technologies and next generation sequencing are ...
(Date:2/8/2017)... -- Aware, Inc. (NASDAQ: AWRE ), a leading supplier ... its quarter and year ended December 31, 2016. ... million compared to $6.9 million in the same quarter last ... $0.6 million compared to $2.6 million in the fourth quarter ... was $0.5 million, or $0.02 per diluted share, which compares ...
(Date:2/8/2017)... 2017 Report Highlights The global ... $8.3 billion in 2016 at a compound annual growth ... Report Includes - An overview of the global market ... data from 2015 and 2016, and projections of compound ... the market on the basis of product type, source, ...
Breaking Biology News(10 mins):