Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:6/22/2017)... ... June 22, 2017 , ... For the ... has produced a Spotlight series on “Cell Therapy Regulation” for its ... leading experts on the unique regulatory challenges of stem cell medical research. , ...
(Date:6/20/2017)... ... June 20, 2017 , ... CTNext , Connecticut’s ... has formed a Higher Education Entrepreneurship Advisory Committee to implement the recommendations of ... other high-ranking representatives from 35 higher education institutions across the state over the ...
(Date:6/20/2017)... Parsippany, NJ (PRWEB) , ... June 20, 2017 , ... ... OHAUS makes the transition from being a trusted supplier in the weighing industry, to ... including cell extractions, ELISA essays, enzyme reactions, immunoassays, hybridizations and more, allowing for ...
(Date:6/19/2017)... ... June 19, 2017 , ... A colony of healthy honey bees is like ... delivering pollen and nectar containing nutrients necessary for growth and survival. Better nutrition gives ... recent indicators point to a decline in honey bee health. Sick and weakened bees ...
Breaking Biology Technology:
(Date:4/11/2017)... , April 11, 2017 Crossmatch®, a ... authentication solutions, today announced that it has been ... Research Projects Activity (IARPA) to develop next-generation Presentation ... "Innovation has been a driving force ... program will allow us to innovate and develop ...
(Date:4/5/2017)... , April 5, 2017  The Allen Institute ... Allen Cell Explorer: a one-of-a-kind portal and dynamic digital ... 3D imaging data, the first application of deep learning ... human stem cell lines and a growing suite of ... platform for these and future publicly available resources created ...
(Date:3/30/2017)... March 30, 2017  On April 6-7, 2017, ... Genome hackathon at Microsoft,s headquarters in ... will focus on developing health and wellness apps that ... Hack the Genome is the first hackathon for ... world,s largest companies in the genomics, tech and health ...
Breaking Biology News(10 mins):