Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:10/11/2017)... Wayne. NJ (PRWEB) , ... October 11, 2017 , ... Personal eye wash is a ... rinse one eye at a time. So which eye do you rinse first if a ... you have Plum Duo Eye Wash with its unique dual eye piece. , ...
(Date:10/11/2017)... ... October 11, 2017 , ... Disappearing forests and increased ... of over 5.5 million people each year. Especially those living in larger cities are ... - based in one of the most pollution-affected countries globally - decided to take ...
(Date:10/10/2017)... (PRWEB) , ... October 10, 2017 , ... ... Science Center’s FirstHand program has won a US2020 STEM Mentoring Award. Representatives of ... award for Excellence in Volunteer Experience from US2020. , US2020’s mission is to ...
(Date:10/10/2017)... ... October 10, 2017 , ... The ... prestigious awards honoring scientists who have made outstanding contributions to analytical ... during Pittcon 2018, the world’s leading conference and exposition for laboratory science, which ...
Breaking Biology Technology:
(Date:10/4/2017)... BLOOMINGTON, Ill. , Oct. 4, 2017  GCE Solutions, a ... powerful new data and document anonymization solution on October 4, 2017. ... the pharmaceutical field to comply with policy 0070 of the European ... documents and data. ... Innovation by GCE Solutions ...
(Date:6/23/2017)... and ITHACA, N.Y. , June 23, ... University, a leader in dairy research, today announced a ... to help reduce the chances that the global milk ... of this dairy project, Cornell University has become the ... the Food Supply Chain, a food safety initiative that ...
(Date:5/6/2017)... RAM Group , Singaporean based ... in biometric authentication based on a novel  ... to perform biometric authentication. These new sensors are based on ... Ram Group and its partners. This sensor will have ... and security. Ram Group is a next generation ...
Breaking Biology News(10 mins):