Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:10/12/2017)... ... October 12, 2017 , ... ... prospective clinical study that demonstrates the accuracy of the FebriDx® test, a ... significant acute bacterial and viral respiratory tract infections by testing the body’s ...
(Date:10/11/2017)... ... 11, 2017 , ... The CRISPR-Cas9 system has ... and avoiding the use of exogenous expression plasmids. The simplicity of programming this ... gain-of-function studies. , This complement to loss-of-function studies, such as with RNAi ...
(Date:10/11/2017)... LAGUNA HILLS, Calif. , Oct. 11, 2017 ... London (ICR) and University of ... prognostic tool to risk-stratify patients with multiple myeloma (MM), in ... nine . The University of Leeds ... by Myeloma UK, and ICR will perform the testing services ...
(Date:10/10/2017)... ... October 10, 2017 , ... ... (ADC) therapeutics, today confirmed licensing rights that give it exclusive global access ... developed in collaboration with Children’s Hospital Los Angeles (CHLA). Additionally, an ...
Breaking Biology Technology:
(Date:3/24/2017)... The Controller General of Immigration from Maldives Mr. ... have received the prestigious international IAIR Award for the most innovative ... ... Maldives Immigration ... Algeen (small picture on the right) have received the IAIR award for ...
(Date:3/23/2017)... PUNE, India , March 23, 2017 The report ... Equipment, Touchless Biometric), Industry, and Geography - Global Forecast to 2022", published by ... growing at a CAGR of 29.63% between 2017 and 2022. ... ... Logo ...
(Date:3/22/2017)... March 21, 2017   Neurotechnology , a ... technologies, today announced the release of the ... provides improved facial recognition using up to 10 ... single computer. The new version uses deep neural-network-based ... and it utilizes a Graphing Processing Unit (GPU) ...
Breaking Biology News(10 mins):