Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:2/23/2017)... ... February 23, 2017 , ... ... evaluation of multiple immunoassay-based threat detection technologies by researchers from the Pacific ... biosensor threat detection technology was found to have the best level of ...
(Date:2/23/2017)... ... ... Today, researchers can fast-track sample collection and analysis for ... or SNPs of interest) using one, easy-to-collect saliva sample. With the addition of ... and other relevant biomarkers can be extensively studied through a non-invasive sample type. ...
(Date:2/23/2017)... , Feb. 23, 2017  Capricor Therapeutics, Inc. (NASDAQ: CAPR), ... medical conditions, today announced that Linda Marbán, Ph.D, president and ... investor conferences: Cowen and Company 37th ... am ET Boston, MA ... 9:00 am PT (12:00 pm ET) Dana Point, ...
(Date:2/23/2017)... FRANCISCO , Feb. 23, 2017   ViaCyte, ... Type 1, a not-for-profit advocacy and education group for ... grant from Beyond Type 1 to support ViaCyte,s efforts ... other insulin-requiring diabetes.  For more than ... cell replacement therapies with a focus on the treatment ...
Breaking Biology Technology:
(Date:2/3/2017)... 2017 A new independent identity strategy consultancy ... (IdSP) . Designed to fill a critical niche in ... founding partners Mark Crego and Janice ... in identity expertise that span federal governments, the 9/11 ... Crego-Kephart combined expertise has a common theme born from ...
(Date:2/2/2017)... 1, 2017  Central to its deep commitment ... worldwide, The Japan Prize Foundation today announced the ... pushed the envelope in their respective fields of ... scientists are being recognized with the 2017 Japan ... only contribute to the advancement of science and ...
(Date:1/30/2017)... 2017   Invitae Corporation (NYSE: ... companies, today announced that it will report its fourth ... guidance on Monday, February 13, 2017, and Invitae,s management ... 4:45 p.m. Eastern / 1:45 p.m. Pacific. ... review financial results, guidance, and recent developments and will ...
Breaking Biology News(10 mins):