Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:3/27/2021)... ... March 24, 2021 , ... ... Life Sciences and Healthcare firms of all sizes, adds depth to its team ... specialist. Pardillo, who earned his doctorate in computational chemistry from Florida International University ...
(Date:3/27/2021)... ... March 24, 2021 , ... ABI Wellness, ... and reporting approach designed under CEO Mark Watson, today announced a webinar dedicated ... featuring guest speakers Dr. Cameron Clark, Neuropsychologist and Founder of Sharp Thinking, and ...
(Date:3/27/2021)... ... ... The Xtalks editorial team is pleased to announce the launch of the ... joined by editorial team members Ayesha Rashid, Sydney Perelmutter and Mira Nabulsi to discuss ... including insights from industry experts. , The Xtalks Life Science podcast will feature ...
(Date:3/23/2021)... Conn. (PRWEB) , ... March 23, 2021 , ... ... develops solutions for characterizing microbiome populations down to the strain level, recently unveiled ... applications. , Not all microbes are created equal: some are easy to ...
Breaking Biology Technology:
(Date:3/27/2021)... ... March 25, 2021 , ... Phlexglobal announced ... Planet Group, has selected Phlexglobal and its innovative regulatory SaaS software, PhlexSubmission, as ... a comprehensive review of five regulatory software companies, with the review team including ...
(Date:3/27/2021)... ... 25, 2021 , ... The 2021 Virtual Conference on Clinical Trial Supply-Europe ... More and more, clinical trial supply conferences are featuring speakers and forums that ... Asymmetrex’s founder and CEO, James L. Sherley, M.D., Ph.D., presented a talk ...
(Date:3/23/2021)... ... March 23, 2021 , ... G-CON Manufacturing (G-CON), the ... by Matica Biotechnology (Matica Bio), a contract development and manufacturing organization (CDMO) specializing ... the cleanroom build out for its new GMP production facility in College Station, ...
Breaking Biology News(10 mins):