Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:2/4/2016)... 4, 2016  Spherix Incorporated (Nasdaq: SPEX ) -- an ... monetization of intellectual property, today provided an update on ... Northern District of Texas and ... Inter Partes Re-examination ("IPR") proceedings that VTech ... IPR was initiated on only certain claims of two ...
(Date:2/4/2016)... Strasbourg, France , to the US ... Strasbourg, France , to the US company Advanced Bioscience ... announce that it acted as an advisor to Transgene on ... Strasbourg, France , to the US company Advanced Bioscience ... Transgene (Euronext: TNG), a member of Institut Mérieux, is ...
(Date:2/3/2016)... , Feb. 3, 2016  Discovery Laboratories, Inc. ... on developing aerosolized KL4 surfactant therapies for respiratory ... has approved an inducement award as a component ... its newly appointed President and Chief Executive Officer.  ... Committee on February 1, 2016 and granted as ...
(Date:2/3/2016)... YORK and HOLLISTON, Mass., Feb. 3, 2016 ... HART ), a biotechnology company developing bioengineered ... trachea and bronchus, today announced that CEO ... BIO CEO & Investor Conference on Tuesday, ... New York City . HART,s ...
Breaking Biology Technology:
(Date:1/20/2016)... LONDON , Jan. 20, 2016 A ... positioned to directly benefit from the explosion in genomics ... from Howe Sound Research. A range of dynamic trends ... ...... - personalized medicine - pharmacogenomics - pathogen ... economies with large markets - greater understanding of the ...
(Date:1/15/2016)... Jan. 15, 2016 Recent publicized breaches in ... find new ways to ensure data security and user ... and Android that ties a user,s ... it into a hardware authorization token. Customer service agents ... fingerprint on their KodeKey enabled device to verify their ...
(Date:1/11/2016)... 11, 2016  higi, the leading retail and ... locations, web and mobile, today announced it has ... existing investors. --> ... further innovate higi,s health platform – its network ... – including expanding services and programs to retail ...
Breaking Biology News(10 mins):