Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:2/12/2016)... ... February 12, 2016 , ... The Pittcon 2016 Exposition, ... Georgia, will include 848 exhibitors (count as of February 9) of which 119 ... services used by the scientific community in industrial, academic, and government labs. The ...
(Date:2/11/2016)... DIEGO, Feb. 11, 2016  Neurocrine Biosciences, Inc. (NASDAQ: NBIX ... ended December 31, 2015. --> ... a net loss of $29.3 million, or $0.34 loss per share, ... per share for the same period in 2014. For the year ... $88.9 million, or $1.05 loss per share, as compared to a ...
(Date:2/11/2016)... ATLANTA , Feb. 11, 2016  Wellcentive ... a Portland, Oregon -based community ... to provide population health analytics, quality reporting and ... help FamilyCare strengthen its team of quality managers, ... reporting to the provider groups serving FamilyCare members. ...
(Date:2/11/2016)... ... February 11, 2016 , ... Reichert ... years, continues today to pursue the highest level of accuracy and quality with ... AR9 Refractometer and the AR5 Refractometer. Accurate, reliable and tough enough for ...
Breaking Biology Technology:
(Date:2/8/2016)... , February 8, 2016 ... payment platform which presents innovation for clients, comfort ... feature called VoiceKey. --> Worldcore ... presents innovation for clients, comfort and unbeatable security, ... --> Worldcore is the ...
(Date:2/3/2016)... Vigilant Solutions announces today that the ... Missouri solved two recent hit-and-run cases with ... Vigilant Solutions. Brian Wenberg explains, "I ... was walking out of a convenience store and witnessed an elderly male back ... striking his vehicle and leaving the scene.  In his ...
(Date:2/2/2016)... 2, 2016 Technology Enhancements Accelerate Growth of X-ray ... the digital and computed radiography markets in ... Indonesia (TIM). It provides an ... as well as regional market drivers and restraints. The ... penetration and market attractiveness, both for digital and computed ...
Breaking Biology News(10 mins):