Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:4/29/2016)... ... 2016 , ... During a two day program for start-up ... CereScan’s CEO, John Kelley, joined other Denver business leaders in providing business basics ... Denver area business community, shared his top fundamental learnings in building an effective, ...
(Date:4/28/2016)... , April 28, 2016 ... reports the Company,s CEO  was featured in an ... Enter When VCs Fear To Tread: ... magazine is an essential business journal ... from emerging biotechs to Big Pharmas. Their content ...
(Date:4/27/2016)... ... 2016 , ... Cambridge Semantics, the leading provider of Smart Data ... has been named to The Silicon Review’s “20 Fastest Growing Big Data Companies of ... serves the needs of end users facing some of the most complex data challenges ...
(Date:4/27/2016)... and RESEARCH TRIANGLE PARK, N.C. , ... UTHR ) announced today that Martine Rothblatt ... Therapeutics will provide an overview and update on the ... Annual Health Care Conference. The presentation will ... a.m. Eastern Time, and can be accessed via a ...
Breaking Biology Technology:
(Date:3/22/2016)... 2016 According to ... for Consumer Industry by Type (Image, Motion, Pressure, ... & IT, Entertainment, Home Appliances, & Wearable ... 2022", published by MarketsandMarkets, the market for ... USD 26.76 Billion by 2022, at a ...
(Date:3/15/2016)... , March 15, 2016 ... report published by Transparency Market Research "Digital Door Lock Systems ... Forecast 2015 - 2023," the global digital door lock systems ... Mn in 2014 and is forecast to grow at a ... of micro, small and medium enterprises (MSMEs) across the world ...
(Date:3/11/2016)... -- --> --> ... Market by Technology (Pattern Recognition), by Component (Hardware, Software, ... (On-Premises and Cloud), by Industry Vertical and by Region ... global market is expected to grow from USD 12.49 ... at a CAGR of 19.1%. , ...
Breaking Biology News(10 mins):