Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:6/23/2016)... 23, 2016   Boston Biomedical , an ... designed to target cancer stemness pathways, announced that ... Orphan Drug Designation from the U.S. Food and ... cancer, including gastroesophageal junction (GEJ) cancer. Napabucasin is ... inhibit cancer stemness pathways by targeting STAT3, and ...
(Date:6/23/2016)... SILVER SPRING, Md. , June 23, 2016 ... evidence collected from the crime scene to track the criminal ... sick, and the U.S. Food and Drug Administration (FDA) uses ... Sound far-fetched? It,s not. ... whole genome sequencing to support investigations of foodborne illnesses. Put ...
(Date:6/23/2016)... ... June 23, 2016 , ... Charm Sciences, Inc. is ... has received AOAC Research Institute approval 061601. , “This is another AOAC-RI approval ... Bob Salter, Vice President of Regulatory and Industrial Affairs. “The Peel Plate methods ...
(Date:6/23/2016)... YORK , June, 23, 2016  The Biodesign ... to envision new ways to harness living systems and ... Modern Art (MoMA) in New York City ... than 130 participating students, showcased projects at MoMA,s Celeste ... Paola Antonelli , MoMA,s senior curator of architecture ...
Breaking Biology Technology:
(Date:6/7/2016)... 2016  Syngrafii Inc. and San Antonio Credit ... includes integrating Syngrafii,s patented LongPen™ eSignature "Wet" solution ... will result in greater convenience for SACU members ... maintaining existing document workflow and compliance requirements. ... Highlights: ...
(Date:6/1/2016)... 1, 2016 Favorable Government Initiatives ... and Criminal Identification to Boost Global Biometrics System Market ... TechSci Research report, " Global Biometrics Market By ... and Opportunities, 2011 - 2021", the global biometrics market ... on account of growing security concerns across various end ...
(Date:5/9/2016)... -- Elevay is currently known as the ... high net worth professionals seeking travel for work   ... there is still no substitute for a face-to-face meeting. ... deal with a firm handshake. This is why wealthy ... citizenship via investment programs like those offered by the ...
Breaking Biology News(10 mins):