Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:2/10/2016)... Early-career researchers from ... , Uganda and Yemen ... nutrition   Indonesia , Nepal ... Yemen are being honored for their accomplishments in ... celebrated for mentoring young women scientists who are pursuing careers in agriculture, ...
(Date:2/10/2016)... ASAE is introducing a hybrid membership model which will ... of joining or renewing through an organizational purchasing model. ... every employee in any size association or AMC office ... member benefits.   John H. Graham, IV ... allow organizations of any size and their employees to ...
(Date:2/10/2016)... , Feb. 10, 2016  Allergan plc (NYSE: ... that Brent Saunders , Allergan,s CEO and President, ... fireside chat session at the RBC Capital Markets Healthcare ... ET at The New York Palace Hotel in ... be webcast live and can be accessed on Allergan,s ...
(Date:2/10/2016)... , ... February 10, 2016 , ... ... the International Society of Pharmaceutical Engineering (ISPE) Rocky Mountain Chapter 21st Annual Vendor ... expecting to fill more than 100 tables for its annual event, which will ...
Breaking Biology Technology:
(Date:2/10/2016)... 10, 2016 ... 2016 iris recognition market report, combined with ... more widely accepted for border control. Some ... and iris recognition technology in a single ... purchasing two individual biometrics devices. ...
(Date:2/9/2016)... Vigilant Solutions announces today that an agency used ... a lead in a difficult homicide case. The agency then ... the suspect vehicle. Due to the ongoing investigation, the agency ... at the agency,s request. --> ... was found deceased at an intersection here in the City. ...
(Date:2/5/2016)... , Feb. 5, 2016 ... addition of the "Global Facial Recognition ... --> ) has announced ... Recognition Market 2016-2020" report to their ... ( ) has announced the addition ...
Breaking Biology News(10 mins):