Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:2/24/2017)... (NASDAQ: VWR), the leading global independent provider of product and ... financial results for the fourth quarter and full year ended ... 4Q16 record quarterly net sales of $1.13 billion, up 1.6% ... 4Q16 EMEA-APAC segment net sales increased 0.4%, ... sales increased 2.5%, or down 0.9% on an organic basis, ...
(Date:2/23/2017)... SAN RAFAEL, Calif., Feb. 23, 2017 ... of U.S. dollars, except per share data, unaudited)Three Months ... ChangeTotal BioMarin Revenue $ ...     22832%$ 1,117$   89026%Aldurazyme Net Product Revenue ... 906538%34823946%Naglazyme Net Product Revenue  ...
(Date:2/23/2017)... Calif. , Feb. 23, 2017  MIODx ... license for two key immunotherapy technologies from the ... technology provides a method to monitor a patient ... as PD-L1 and CTLA-4.  The second license extends ... a patient is likely to have an immune-related ...
(Date:2/23/2017)... , Feb. 23, 2017  Imanis Life ... product line of oncolytic vaccinia viruses for virotherapy ... as part of Genelux,s proprietary, vaccinia virus-based technology ... excited to enter into a partnership with Genelux ... oncolytic vaccinia viruses for use in research," said ...
Breaking Biology Technology:
(Date:2/24/2017)... -- EyeLock LLC, a leader of iris-based identity authentication ... solution on the latest Qualcomm® Snapdragon™ 835 mobile ... Congress 2017 (February 27 – March 2, ... Stand 3E10. The Snapdragon 835 ... combination of hardware, software and biometrics technologies ...
(Date:2/21/2017)... , February 21, 2017 Der ... US-Dollar wachsen. Nach einem Gespräch mit mehr als 50 Vertretern ... Hindernisse zu überwinden gilt, um diese Prognose zu realisieren. ... ... die Mobilisierung der finanziellen Mittel für die Biobank, die ...
(Date:2/13/2017)... , Feb. 13, 2017  RSA Conference -- ... platform that is designed to enhance fraud detection ... release in the RSA Fraud & Risk Intelligence ... organizations to leverage additional insights from internal and ... to better protect their customers from targeted cybercrime ...
Breaking Biology News(10 mins):