Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:4/21/2017)... , ... April 21, 2017 , ... ... dedicated to nourishing a range of emerging technology-based businesses, recently earned a $77,518 ... Court location. , Founded in 2004, FITCI is Frederick’s first incubator. A ...
(Date:4/20/2017)... ... , ... USDM Life Sciences , the leading risk management, technological innovation ... to announce Holger Braemer as Vice President of its Europe division and ... , Braemer is an integral part of USDM’s expansion of services and solutions ...
(Date:4/20/2017)... , ... April 20, 2017 , ... ... sources for advanced technology applications, announced today that Chief Executive Officer (CEO) Debbie ... SEMI is the global industry association connecting the electronics manufacturing supply ...
(Date:4/20/2017)... Israel , April 20, 2017  BrainStorm ... stem cell technologies for neurodegenerative diseases, announced today that ... Alliance for Regenerative Medicine,s (ARM) 5 th Annual Cell ... at 09:40 EDT in Boston . ... Chief Medical Officer & Chief Operating Officer, will participate in ...
Breaking Biology Technology:
(Date:3/24/2017)... -- Research and Markets has announced the addition of ... - Industry Forecast to 2025" report to their offering. ... The Global Biometric Vehicle ... around 15.1% over the next decade to reach approximately $1,580 million ... estimates and forecasts for all the given segments on global as ...
(Date:3/22/2017)... 21, 2017 Vigilant Solutions , a ... enforcement agencies, announced today the appointment of retired FBI ... public safety business development. Mr. Sheridan brings ... including a focus on the aviation transportation sector, to ... position, Mr. Sheridan served as the Aviation Liaison Agent ...
(Date:3/9/2017)... , Australia , March 9, ... study data at the prestigious World Lung Imaging Workshop ... Andreas Fouras , was invited to deliver the ... pulmonary medicine. This globally recognised event brings together leaders ... share the latest developments in lung imaging. ...
Breaking Biology News(10 mins):