Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
ABCB4
ABCC1
ABL
AKAP13
AKT1
AKT2
APC
AR
ATM
BAD
BAG1
BAK1 BARD1
BAX
BCL2
BCL3
BCL6
BCR
BRAF
BRCA1
BRCA2
CBL
CCND1
CCNE1
CDH1 CDH13
CDK4
CDKN1A
CDKN1B
CDKN1C
CDKN2A
CDKN3
CHEK1
CHEK2
CRK
CSF1R
DCC DEK EEF1A2
EGFR
EIF3S3
EIF4E
ELK1
EPHA1
ERBB2
ERBB3
ERBB4
ERG
ESR1
ETS1
ETS2 FES
FGF3
FGF4
FGF6
FGFR1
FGFR2
FGR
FLI1
FOS
FYN
GADD45A
GADD45B
GADD45G GLI
GNAI2
GRO1
HCC-4
HCK
HRAS
JUN
JUND
KAI1
KIT
KRAS2
LCK
MADH2 MADH4
MAF
MAFF
MAS1
MAX
MCF2
MDM2
MEL
MEN1
MET
MLH1
MOS
MPL MSH2
MYB
MYB1
MYC
MYCL1
MYCN
NCOA1
NCOA3
NET1
NF1
NF2
NFKB2
NRAS NTRK1
PAX2
PDGFB
PGR
PIM1
PTCH
PTEN
RAF1
RARA
RB1
REL
RET
ROS1 RPS6KB1
RUNX1
SAS
SKI
SRC
TAL1
TGFBR1
TGFBR2
THRA
TIAM1
TLX1
TNFRSF1B
TNFRSF6 TP53
VAV1
VHL
WNT1
WNT2
WNT5A
WNT7B
WT1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
symbol
Accession # Unigene Target
location
Coding
region
siRNA target %GC
ABCB1
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
*Name:
*Comment:
*Email:


(Date:6/27/2016)... ... June 27, 2016 , ... Newly created 4Sight Medical ... to the healthcare market. The company's primary focus is on new product introductions, ... strategies that are necessary to help companies efficiently bring their products to market. ...
(Date:6/24/2016)... , June 24, 2016 Epic ... sensitively detects cancers susceptible to PARP inhibitors by ... tumor cells (CTCs). The new test has already ... therapeutics in multiple cancer types. Over ... DNA damage response pathways, including PARP, ATM, ATR, ...
(Date:6/23/2016)... 2016   Boston Biomedical , an industry ... to target cancer stemness pathways, announced that its ... Drug Designation from the U.S. Food and Drug ... including gastroesophageal junction (GEJ) cancer. Napabucasin is an ... cancer stemness pathways by targeting STAT3, and is ...
(Date:6/23/2016)... Prostate Cancer Foundation (PCF) is pleased to announce 24 new Young ... cancer. Members of the Class of 2016 were selected from a pool of ... More About the Class of 2016 PCF Young Investigators ... ... ...
Breaking Biology Technology:
(Date:4/19/2016)... DUBAI , UAE, April 20, 2016 ... can be implemented as a compact web-based "all-in-one" system ... in the biometric fingerprint reader or the door interface ... requirements of modern access control systems. The minimal dimensions ... the ID readers into the building installations offer considerable ...
(Date:4/14/2016)... , April 14, 2016 ... and Malware Detection, today announced the appointment of ... the new role. Goldwerger,s leadership appointment comes ... the heels of the deployment of its platform at ... behavioral biometric technology, which discerns unique cognitive and physiological ...
(Date:3/31/2016)... , March 31, 2016  Genomics firm Nabsys has ... CEO, Barrett Bready , M.D., who returned to ... the original technical leadership team, including Chief Technology Officer, ... Product Development, Steve Nurnberg and Vice President of Software ... the company. Dr. Bready served as CEO ...
Breaking Biology News(10 mins):