Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:5/25/2016)... , ... May 25, 2016 , ... ... a variety of fracture-specific plating options designed to address fractures of the distal ... fixation solutions. , The Acumed Ankle Plating System 3 is composed of seven ...
(Date:5/25/2016)... ... May 25, 2016 , ... Scientists at the University of Athens say ... mesothelioma may be hampering the research that could lead to one good one. Surviving ... read it now. , The team evaluated 98 mesothelioma patients who ...
(Date:5/25/2016)... ... May 25, 2016 , ... Biohaven ... Administration (FDA) has granted the company’s orphan drug designation request covering BHV-4157 for ... designation granted by the FDA. , Spinocerebellar ataxia is a rare, debilitating ...
(Date:5/24/2016)... ... ... Last week, Callan Capital, an integrated wealth management firm specializing in asset ... Diego Life Science event at the Estancia La Jolla Resort and Spa. , Over ... Dr. Rich Heyman, former CEO of Aragon and Seragon, and Faheem Hasnain, former CEO ...
Breaking Biology Technology:
(Date:3/17/2016)... ABI Research, the leader in transformative ... market will reach more than $30 billion by ... Consumer electronics, particularly smartphones, continue to boost the ... reach two billion shipments by 2021 at a ... Research Analyst at ABI Research. "Surveillance is also ...
(Date:3/15/2016)... March 15, 2016 Yissum Research Development ... technology-transfer company of the Hebrew University, announced today the ... sensing technology of various human biological indicators. Neteera Technologies ... million from private investors. ... the detection of electromagnetic emissions from sweat ducts, enables ...
(Date:3/14/2016)... ) - ... - Renvoi : image disponible via AP Images ( ... --> DERMALOG, le leader de l,innovation ... d,empreintes digitales pour l,enregistrement des réfugiés en Allemagne. ... produire des cartes d,identité aux réfugiés. DERMALOG dévoilera ...
Breaking Biology News(10 mins):