Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:2/10/2016)... DUBLIN , Feb. 10, 2016  Allergan plc ... today announced that Brent Saunders , Allergan,s CEO ... in a fireside chat session at the RBC Capital ... 12:30 p.m. ET at The New York Palace Hotel ... presentation will be webcast live and can be accessed ...
(Date:2/10/2016)... Springfield, MO (PRWEB) , ... February 10, 2016 ... ... company, will attend the International Society of Pharmaceutical Engineering (ISPE) Rocky Mountain Chapter ... of ISPE is expecting to fill more than 100 tables for its annual ...
(Date:2/10/2016)... ... 10, 2016 , ... PatientCrossroads announces that the ... online PatientCrossroads platform, has exceeded both its one-year and overall recruitment goals since ... which seeks to advance understanding of the hereditary risks for certain kinds of ...
(Date:2/10/2016)... ... ... Cenna Bioscience Inc., an emerging biopharmaceutical company focused on the discovery and ... been selected to present at the Cavendish Global Health Impact Forum taking place February ... of the Forum is to help family offices and foundations develop and implement their ...
Breaking Biology Technology:
(Date:2/5/2016)... DUBLIN , Feb. 5, 2016 /PRNewswire/ ... the addition of the "Global Facial ... offering. --> ) has ... Facial Recognition Market 2016-2020" report to ... Markets ( ) has announced the ...
(Date:2/3/2016)... , February 4, 2016 --> ... to SEK 1,351.5 M (105.0), up 1,187% compared with fourth quarter of ... amounted to SEK 517.6 M (loss: 30.0). Earnings per share ... activities was SEK 537.4 M (neg: 74.7). , ... , Revenues amounted to SEK 2,900.5 M (233.6), up 1,142% compared with ...
(Date:2/3/2016)... , Feb. 3, 2016 Vigilant Solutions ... Police Department in Missouri solved ... plate reader (LPR) data from Vigilant Solutions. ... case in which the victim was walking out of a convenience store and ... space next to his vehicle, striking his vehicle and ...
Breaking Biology News(10 mins):