Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:2/4/2016)... 2016 - New FDA action date of ... FDA action date of July 22, 2016   ... 22, 2016   - Lifitegrast has ... indicated for the treatment of signs and symptoms of dry eye ... potential to be the only product approved in the U.S. in the past decade indicated ...
(Date:2/4/2016)... ... ... Shimadzu Scientific Instruments will showcase several new products, including ... and present on the analysis of mycotoxins and medical cannabis at the Pittcon ... the Georgia World Congress Center in Atlanta, Georgia. , Attendees should stop ...
(Date:2/4/2016)... , Feb. 4, 2016 Beike Biotechnology, the ... medical institutions attended a ceremony in late 2015 to ... cell therapy in 2016. --> ... Translation Platform for Personalized Cell Therapy" was hosted by ... Production Center, both subsidiaries of Beike Biotechnology Co., Ltd. ...
(Date:2/4/2016)... and MENLO PARK, Calif. , Feb. ... ("DelMar" and the "Company"), a biopharmaceutical company focused on the ... it will present at the 18 th Annual ... 2016 at 10:00 a.m. EST in New York, ... president and CEO, will provide an update on the ongoing ...
Breaking Biology Technology:
(Date:2/3/2016)... , February 3, 2016 ... market research report "Automated Fingerprint Identification System Market by ... Search), Application (Banking & Finance, Government, Healthcare, and Transportation) ... MarketsandMarkets, the market is expected to be worth USD ... 21.0% between 2015 and 2020. The transformation and technology ...
(Date:2/2/2016)... 2016  BioMEMS devices deployed in hospitals ... medical screening and diagnostic applications, such as ... that facilitate and assure continuous monitoring without ... being bolstered through new opportunities offered by ... coupled with wireless connectivity and low power ...
(Date:2/2/2016)... , Feb. 2, 2016 Technology Enhancements Accelerate Growth ... analysis of the digital and computed radiography markets in ... , and Indonesia (TIM). It ... market size, as well as regional market drivers and ... discusses market penetration and market attractiveness, both for digital ...
Breaking Biology News(10 mins):