Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:6/24/2016)... June 24, 2016  Regular discussions on a range of ... between the two entities said Poloz. Speaking at ... Ottawa , he pointed to the country,s inflation target, ... government. "In certain ... institutions have common economic goals, why not sit down and ...
(Date:6/24/2016)... , ... June 24, 2016 , ... Researchers at the ... commonly-identified miRNAs in people with peritoneal or pleural mesothelioma. Their findings are the subject ... it now. , Diagnostic biomarkers are signposts in the blood, lung fluid or ...
(Date:6/23/2016)... Mass. , June 23, 2016   ... development of novel compounds designed to target cancer ... napabucasin, has been granted Orphan Drug Designation from ... the treatment of gastric cancer, including gastroesophageal junction ... stemness inhibitor designed to inhibit cancer stemness pathways ...
(Date:6/23/2016)... Houston Methodist Willowbrook Hospital has signed ... to serve as their official health care provider. ... will provide sponsorship support, athletic training services, and ... volunteers, athletes and families. "We are ... and to bring Houston Methodist quality services and ...
Breaking Biology Technology:
(Date:6/16/2016)... June 16, 2016 The ... expected to reach USD 1.83 billion by 2024, ... Research, Inc. Technological proliferation and increasing demand in ... expected to drive the market growth. ... The development of advanced multimodal techniques for ...
(Date:6/9/2016)... -- Perkotek an innovation leader in attendance control systems is proud to announce the introduction ... to make sure the right employees are actually signing in, and to even control ... ... ... ...
(Date:6/7/2016)... June 7, 2016  Syngrafii Inc. and San ... relationship that includes integrating Syngrafii,s patented LongPen™ eSignature ... This collaboration will result in greater convenience for ... union, while maintaining existing document workflow and compliance ... ...
Breaking Biology News(10 mins):