Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:4/27/2017)... ... April 27, 2017 , ... The Council for Agricultural ... to Jayson Lusk, a consummate communicator who promotes agricultural science and technology in ... as he explains how innovation and growth in agriculture are critical for food ...
(Date:4/26/2017)... (PRWEB) , ... April 26, 2017 , ... ... FDA’s GMP expectations for phase I clinical trials comes to Tampa, San Francisco ... biotechnology and pharma professionals representing FDA regulated organizations such as Pfizer Inc., Teva ...
(Date:4/26/2017)... 2017  Genisphere LLC, provider of the 3DNA ... collaborative and sponsored research agreement with the University ... The overall goal of the partnership is to ... designs and formulations after in vivo ... vasculature as well as inflammatory responses, demonstrating various ...
(Date:4/25/2017)... ... April 25, 2017 , ... Dr. Robert G. ... , proudly announced today that acclaimed physiatrist Matthew Terzella, MD, has joined the ... 2017. , Dr. Terzella completed his residency in Physical Medicine and Rehabilitation at ...
Breaking Biology Technology:
(Date:3/28/2017)... PUNE, India , March 28, 2017 ... (Analog, IP, Biometrics), Hardware (Camera, Monitors, Servers, Storage Devices), ... Maintenance), Vertical, and Region - Global Forecast to 2022", ... 30.37 Billion in 2016 and is projected to reach ... 15.4% between 2017 and 2022. The base year considered ...
(Date:3/24/2017)... MILAN , March 24, 2017 The Controller ... Deputy Controller Mr. Abdulla Algeen have received the prestigious international ... Continue Reading ... ... small picture) and Deputy Controller Abdulla Algeen (small picture on the right) ...
(Date:3/23/2017)... The report "Gesture Recognition and Touchless Sensing Market by Technology (Touch-based ... to 2022", published by MarketsandMarkets, the market is expected to be worth USD ... 2022. Continue Reading ... ... ...
Breaking Biology News(10 mins):