Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:2/24/2017)... N.J. , Feb. 24, 2017  Driven ... and biotechnology are now the fastest growing categories, ... Specialty Actives in Personal Care: Multi-regional Market ... research and management consulting firm Kline. ... bioprocesses that make them more effective for skin ...
(Date:2/24/2017)... Corporation (NASDAQ: VWR), the leading global independent provider of product ... its financial results for the fourth quarter and full year ... 4Q16 record quarterly net sales of $1.13 billion, up ... 4Q16 EMEA-APAC segment net sales increased ... net sales increased 2.5%, or down 0.9% on an organic ...
(Date:2/23/2017)... ... February 23, 2017 , ... ... portfolio to include an array of biochemical analyses critical for Lead Discovery. ... drive their hit-to-lead and SAR programs, including inhibitor potency and selectivity, mechanism of ...
(Date:2/23/2017)... -- Seattle,s upscale Capitol Hill neighborhood, with its swanky shops, parks and ... lice treatment salon to set up shop. But there,s ... French bistro on E Madison Ave, and CEO Maria ... lice clinic, we pride ourselves on being a destination for ... the stigma associated with lice. Everyone can get lice – ...
Breaking Biology Technology:
(Date:2/2/2017)... -- Central to its deep commitment to honor the ... Prize Foundation today announced the laureates of the ... in their respective fields of Life Sciences and ... recognized with the 2017 Japan Prize for original ... the advancement of science and technology, but also ...
(Date:1/26/2017)... , Jan. 26, 2017  Acuity Market Intelligence ... Biometrics and Digital Identity".  Acuity characterizes 2017 as ... when increased adoption reflects a new understanding of ... "Biometrics and digital identity are often perceived ... Maxine Most , Principal of Acuity Market intelligence. ...
(Date:1/21/2017)... , Jan 20, 2017 Research and ... Biometrics Market 2017-2021" report to their offering. ... The global voice recognition biometrics ... 2017-2021. The report covers the present scenario and ... 2017-2021. To calculate the market size, the report considers the revenue ...
Breaking Biology News(10 mins):