Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
ABCB4
ABCC1
ABL
AKAP13
AKT1
AKT2
APC
AR
ATM
BAD
BAG1
BAK1 BARD1
BAX
BCL2
BCL3
BCL6
BCR
BRAF
BRCA1
BRCA2
CBL
CCND1
CCNE1
CDH1 CDH13
CDK4
CDKN1A
CDKN1B
CDKN1C
CDKN2A
CDKN3
CHEK1
CHEK2
CRK
CSF1R
DCC
DEK EEF1A2
EGFR
EIF3S3
EIF4E
ELK1
EPHA1
ERBB2
ERBB3
ERBB4
ERG
ESR1
ETS1
ETS2 FES
FGF3
FGF4
FGF6
FGFR1
FGFR2
FGR
FLI1
FOS
FYN
GADD45A
GADD45B
GADD45G GLI
GNAI2
GRO1
HCC-4
HCK
HRAS
JUN
JUND
KAI1
KIT
KRAS2
LCK
MADH2 MADH4
MAF
MAFF
MAS1
MAX
MCF2
MDM2
MEL
MEN1
MET
MLH1
MOS
MPL MSH2
MYB
MYB1
MYC
MYCL1
MYCN
NCOA1
NCOA3
NET1
NF1
NF2
NFKB2
NRAS NTRK1
PAX2
PDGFB
PGR
PIM1
PTCH
PTEN
RAF1
RARA
RB1
REL
RET
ROS1 RPS6KB1
RUNX1
SAS
SKI
SRC
TAL1
TGFBR1
TGFBR2
THRA
TIAM1
TLX1
TNFRSF1B
TNFRSF6 TP53
VAV1
VHL
WNT1
WNT2
WNT5A
WNT7B
WT1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
symbol
Accession # Unigene Target
location
Coding
region
siRNA target %GC
ABCB1
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Cancer siRNA Oligo Set Version

(Date:8/18/2014)... (PRWEB) August 19, 2014 2014 ... Industryā€¯ is a professional and in-depth research report ... basic Linalool information, including its definition, classification, ... industry overview. This research covers the international market ... global industry analysis covering macroeconomic environment & economic ...
(Date:8/18/2014)... 18, 2014 /PRNewswire/ - SQI Diagnostics Inc. (TSX-V: SQD), a ... and products for advanced microarray diagnostics, today announced it ... 22 at 2:00 pm ET.  During ... a brief review of SQI,s recent commercialization progress and ... industry veteran recently appointed to the Board of Directors ...
(Date:8/18/2014)...   Sterne, Kessler, Goldstein & Fox P.L.L.C. , ... DC , announced today that it has filed ... with the U.S. Patent and Trademark Office (USPTO) on ... Inc. (Nasdaq: BRLI).  These IPR petitions aim to nullify ... Inc. These patents have been asserted against GeneDx in ...
(Date:8/18/2014)... 18, 2014 Global HIV Infection Drug ... announced by Reportstack. The rate of HIV infection and the ... declining note at a positive rate across the globe. It ... million in 2005 to 1.5 in 2013, with the rates ... such drastic changes in the infection rates has been the ...
Breaking Biology Technology:Linalool Industry & Diphenylamine Market (Global, China) 2014 Analysis Now Available at DeepResearchReports.com 2Linalool Industry & Diphenylamine Market (Global, China) 2014 Analysis Now Available at DeepResearchReports.com 3Linalool Industry & Diphenylamine Market (Global, China) 2014 Analysis Now Available at DeepResearchReports.com 4SQI Diagnostics Announces Investor Conference Call with Dr. Allan Pronovost 2SQI Diagnostics Announces Investor Conference Call with Dr. Allan Pronovost 3Sterne Kessler Files 11 IPR Petitions On Behalf Of GeneDx, Inc., Subsidiary Of BioReference Laboratories, Inc. 2Sterne Kessler Files 11 IPR Petitions On Behalf Of GeneDx, Inc., Subsidiary Of BioReference Laboratories, Inc. 3Global HIV Infection Drug Market Overview 2Global HIV Infection Drug Market Overview 3Global HIV Infection Drug Market Overview 4
... Nexavar Net Sales increase 107% over Second Quarter 2007, ... ONXX ) today reported its financial results,for the ... reported net income,of $4.5 million, or $0.08 per diluted ... net loss of $10.8 million, or $0.22 per diluted ...
... HILL, N.J., Aug. 5 TriMix Laboratories LLC ... American Pharmacy Solutions,as the exclusive pharmacy for prescription ... by doctors as a first line and secondary,treatment ... a licensed compounding pharmacy which makes TriMix gel(TM) ...
... TEL AVIV, Israel, BADAJOZ, Spain and SINGAPORE, August 5 ... been appointed as the,new Chief Executive Officer effective July ... 20 years of experience in sales,marketing and senior management ... VP of Marketing and Sales at UltraShape Ltd., a ...
Cached Biology Technology:Onyx Pharmaceuticals Reports Second Quarter and Six-Month 2008 Financial Results 2Onyx Pharmaceuticals Reports Second Quarter and Six-Month 2008 Financial Results 3Onyx Pharmaceuticals Reports Second Quarter and Six-Month 2008 Financial Results 4Onyx Pharmaceuticals Reports Second Quarter and Six-Month 2008 Financial Results 5Onyx Pharmaceuticals Reports Second Quarter and Six-Month 2008 Financial Results 6Onyx Pharmaceuticals Reports Second Quarter and Six-Month 2008 Financial Results 7Onyx Pharmaceuticals Reports Second Quarter and Six-Month 2008 Financial Results 8Onyx Pharmaceuticals Reports Second Quarter and Six-Month 2008 Financial Results 9Onyx Pharmaceuticals Reports Second Quarter and Six-Month 2008 Financial Results 10TriMix Laboratories Announces New Partnership With American Pharmacy Solutions 2TriMix Laboratories Announces New Partnership With American Pharmacy Solutions 3Pollogen Announces Appointment of Ms. Yfat Scialom as Chief Executive Officer 2
(Date:8/20/2014)... LAKE CITY Researchers at Huntsman Cancer Institute (HCI) at ... forms of the gene that encodes BCR-ABL, the unregulated ... According to the American Cancer Society, nearly 6,000 new ... Drugs already in use, called tyrosine kinase inhibitors (TKIs), ... They do not cure CML but control it in ...
(Date:8/20/2014)... University of Tbingen, Arizona State University, the Wellcome Trust ... Institute (Swiss TPH) isolated Mycobacterium pinnipedii from ... years old. The pathogen is a relative of the ... disease in humans today. These researchers assume that seals ... "The link to sea lions was unexpected" comments Sebastien ...
(Date:8/20/2014)... SILICON VALLEY, Calif., August 19, 2014 -- Bay Area ... to diagnose and simple to cure, applauds new research ... review journal Ticks and Tick-borne Diseases . ... in Northwest California are active throughout the year, making ... conducted by researchers at California Department of Public Health ...
Breaking Biology News(10 mins):Blueprint for next generation of chronic myeloid leukemia treatment 2Lyme disease risk is year-round in Northwest California, according to new study 2Lyme disease risk is year-round in Northwest California, according to new study 3
... sandpipers ( Calidris pusilla ) feeding during low tide ... Beauchamp, an ornithologist and research officer at the University ... the periphery remained alert and used short pecks to ... the group relaxed their vigilance and fed on a ...
... are the heart of the smaller, better electronics ... new materials, medical diagnostics and therapeutics, energy storage, ... have unintended consequences for human health and the ... and policy makers, the Virginia Tech Center for ...
... long lasting, possibly permanent, performance-enhancing effects, shows a study ... Physiology ., Previously, re-acquisition of muscle mass with ... has been attributed to motor learning. However, this new ... is a cellular ,memory mechanism, within muscle of brief ...
Cached Biology News:Bird buffet requires surveillance 2Nanomaterials database improved to help consumers, scientists track products 2Nanomaterials database improved to help consumers, scientists track products 3Nanomaterials database improved to help consumers, scientists track products 4
12 breakable polypropylene strips of 8 wells each held in a rigid frame. Ideal for antibody assays....
... Designed for in vitro diagnostic assays, ... medical-grade polystyrene for uniform binding, high optical ... the Easy-Washproducts are part of the Certified ... performance to be within QA release specifications. ...
... StabilZyme SELECT Stabilizer is an aqueous solution ... other non-toxic stabilizing chemicals in a saline ... a combination of 0.02% methylisothiazolone and 0.02% ... Stabilizer is a diluent and stabilizer for ...
AC input: 230 V...
Biology Products: