Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
ABCB4
ABCC1
ABL
AKAP13
AKT1
AKT2
APC
AR
ATM
BAD
BAG1
BAK1 BARD1
BAX
BCL2
BCL3
BCL6
BCR
BRAF
BRCA1
BRCA2
CBL
CCND1
CCNE1
CDH1 CDH13
CDK4
CDKN1A
CDKN1B
CDKN1C
CDKN2A
CDKN3
CHEK1
CHEK2
CRK
CSF1R
DCC
DEK EEF1A2
EGFR
EIF3S3
EIF4E
ELK1
EPHA1
ERBB2
ERBB3
ERBB4
ERG
ESR1
ETS1
ETS2 FES
FGF3
FGF4
FGF6
FGFR1
FGFR2
FGR
FLI1
FOS
FYN
GADD45A
GADD45B
GADD45G GLI
GNAI2
GRO1
HCC-4
HCK
HRAS
JUN
JUND
KAI1
KIT
KRAS2
LCK
MADH2 MADH4
MAF
MAFF
MAS1
MAX
MCF2
MDM2
MEL
MEN1
MET
MLH1
MOS
MPL MSH2
MYB
MYB1
MYC
MYCL1
MYCN
NCOA1
NCOA3
NET1
NF1
NF2
NFKB2
NRAS NTRK1
PAX2
PDGFB
PGR
PIM1
PTCH
PTEN
RAF1
RARA
RB1
REL
RET
ROS1 RPS6KB1
RUNX1
SAS
SKI
SRC
TAL1
TGFBR1
TGFBR2
THRA
TIAM1
TLX1
TNFRSF1B
TNFRSF6 TP53
VAV1
VHL
WNT1
WNT2
WNT5A
WNT7B
WT1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
symbol
Accession # Unigene Target
location
Coding
region
siRNA target %GC
ABCB1
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Cancer siRNA Oligo Set Version

(Date:7/24/2014)... worldwide rely on sophisticated equipment, trained personnel, and ... areas against terrorist attacks. A revolutionary new electronic ... make their job much easier. , The groundbreaking ... Tel Aviv University ,s School of Chemistry and ... the Herzliya company Tracense, picks up the scent ...
(Date:7/24/2014)... Yet, scientists are making progress in devising suitable ... approach relies on quantum dotsa kind of artificial ... A new study demonstrates that changing the coupling ... electrical impulses can help better control them. This ... as quantum information units, which would produce faster ...
(Date:7/24/2014)... to settle into equilibriuma state of unchanging balance ... of non-equilibrium conditions where new possibilities lie. Non-equilibrium ... such as temperature fluctuations, freezing and melting, or ... body temperature, airplanes to fly, and the Earth ... even though these conditions exist naturally and are ...
(Date:7/24/2014)... July 24, 2014 Research and Markets ... Genomics and Proteomics Analytical Instruments Market 2014-2018" report ... Genomics is the study of the ... of the structure and functions of proteomes or sets ... and technology. Genomics involves the mapping of genes and ...
Breaking Biology Technology:Nano-sized chip 'sniffs out' explosives far better than trained dogs 2New approach to form non-equilibrium structures 2Global Genomics and Proteomics Analytical Instruments Market 2014-2018: Key Vendors are Agilent, Bio-Rad , F. Hoffmann, La Roche, Illumina, PerkinElmer and Thermo Fisher Scientific 2
... AGREEMENT COVERS MARROWXPRESS(TM) IN KEY GLOBAL MARKETS, ... KOOL ), a leading supplier of innovative ... cells, said today it has signed,a distribution agreement ... used for isolating stem cells from bone,marrow. The ...
... MINNETONKA, Minn., Sept. 9 For the second ... in clinical study management systems, has been recognized ... fastest growing private,organizations. With consistently strong growth over ... growing company in the Twin Cities,metro area, and ...
... of Cervical Cancer Prevention: What Do We Need to Do, Now ... ... HPV Vaccine Era, CHICAGO, Sept. 9 The Society of ... 12-13,2008 at the Hotel SAX in Chicago, IL. Approximately 50 key ...
Cached Biology Technology:ThermoGenesis Announces Distribution Agreement for Bone Marrow Stem Cell Device 2ThermoGenesis Announces Distribution Agreement for Bone Marrow Stem Cell Device 3ThermoGenesis Announces Distribution Agreement for Bone Marrow Stem Cell Device 4MedNet Solutions Again Recognized as one of the Fastest Growing US Companies 2Society of Gynecologic Oncologists to Host Cervical Cancer Prevention Forum 2Society of Gynecologic Oncologists to Host Cervical Cancer Prevention Forum 3
(Date:7/24/2014)... species of fish, according to a new study ... tested fish anti-predator behaviour. , Three-spined sticklebacks ... when exposed to additional noise, whereas no effects ... author Dr Irene Voellmy of Bristol,s School of ... environments have increased substantially during the last few ...
(Date:7/24/2014)... sticky research out of York University shows a surprisingly ... toxic grass fungus: moose saliva (yes moose saliva). ... "Ungulate saliva inhibits a grassendophyte mutualism" shows that moose ... (which hosts a fungus called epichlo festucae that produces ... less toxicity. , "Plants have evolved defense mechanisms to ...
(Date:7/24/2014)... at The University of Texas Health Science Center at ... to help Harris County residents whose vision problems cannot ... with corrective lenses, many people with low vision can ... of low vision devices, such as telescopes, magnifiers and ... Iyer is using the three-year, $164,645 SightFirst grant from ...
Breaking Biology News(10 mins):Moose drool inhibits growth of toxic fungus: York U research 2UTHealth Dr. Bhavani Iyer awarded low vision grant 2
... DURHAM, N.H. The angel investor market in the first ... 30 percent market correction in the second half of 2008 ... $8.9 billion, an increase of 4.7 percent over the same ... at the University of New Hampshire. A ...
... Water channels exist not only in nature microscopical ... body, where they ensure that water can be transported through ... of Gothenburg, Sweden, have discovered that one type of the ... more stable , which may be significant in the treatment ...
... National Science Foundation (NSF) has selected a team of ... the new Sustainable Cities - People, Infrastructures and the ... is leading the project, which includes 20 U.S. universities, ... grant aims to bring together scientists from all over ...
Cached Biology News:Angel investor market stabilizes in first half of 2011, UNH Center for Venture Research finds 2Water channels in the body help cells remain in balance 2National Science Foundation selects University of Colorado Denver team to study city sustainability 2