Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
ABCB4
ABCC1
ABL
AKAP13
AKT1
AKT2
APC
AR
ATM
BAD
BAG1
BAK1 BARD1
BAX
BCL2
BCL3
BCL6
BCR
BRAF
BRCA1
BRCA2
CBL
CCND1
CCNE1
CDH1 CDH13
CDK4
CDKN1A
CDKN1B
CDKN1C
CDKN2A
CDKN3
CHEK1
CHEK2
CRK
CSF1R
DCC
DEK EEF1A2
EGFR
EIF3S3
EIF4E
ELK1
EPHA1
ERBB2
ERBB3
ERBB4
ERG
ESR1
ETS1
ETS2 FES
FGF3
FGF4
FGF6
FGFR1
FGFR2
FGR
FLI1
FOS
FYN
GADD45A
GADD45B
GADD45G GLI
GNAI2
GRO1
HCC-4
HCK
HRAS
JUN
JUND
KAI1
KIT
KRAS2
LCK
MADH2 MADH4
MAF
MAFF
MAS1
MAX
MCF2
MDM2
MEL
MEN1
MET
MLH1
MOS
MPL MSH2
MYB
MYB1
MYC
MYCL1
MYCN
NCOA1
NCOA3
NET1
NF1
NF2
NFKB2
NRAS NTRK1
PAX2
PDGFB
PGR
PIM1
PTCH
PTEN
RAF1
RARA
RB1
REL
RET
ROS1 RPS6KB1
RUNX1
SAS
SKI
SRC
TAL1
TGFBR1
TGFBR2
THRA
TIAM1
TLX1
TNFRSF1B
TNFRSF6 TP53
VAV1
VHL
WNT1
WNT2
WNT5A
WNT7B
WT1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
symbol
Accession # Unigene Target
location
Coding
region
siRNA target %GC
ABCB1
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Cancer siRNA Oligo Set Version

(Date:9/1/2015)... ... September 01, 2015 , ... ... been discovered by researchers at the Keck Graduate Institute and its collaborators. The ... , The findings were published online on August 27 by Scientific Reports, an ...
(Date:9/1/2015)... , September 1, 2015 Shire plc ... Sara Mathew to its Board of Directors as ... the Audit, Compliance & Risk Committee of the Shire Board. ... Sara previously served as Chairman, President and Chief ... December 2013. During her 12-year tenure at D&B, she helped ...
(Date:8/31/2015)... ... August 31, 2015 , ... In recent ... properties such as low carbon footprints and compostability. These properties can help in ... plastics. On the basis of applications, the market for biodegradable plastics can be ...
(Date:8/31/2015)... Research and Markets ( http://www.researchandmarkets.com/research/k6lcp2/mexico_biomedical ) has ... Market - Growth, Trends & Forecasts (2014-2020)" report ... Biomedical Sensors market is estimated at $0.20 billion by ... 2014-2020 The near future will bring biomedical ... each individual. These sensors can be set to trigger ...
Breaking Biology Technology:Scientists Discover New Use for an Old Therapy Inhibiting Deadly Pathogens Including Ebola and Anthrax 2Scientists Discover New Use for an Old Therapy Inhibiting Deadly Pathogens Including Ebola and Anthrax 3Scientists Discover New Use for an Old Therapy Inhibiting Deadly Pathogens Including Ebola and Anthrax 4Shire Appoints Sara Mathew to Board of Directors 2Biodegradable Plastics Market Growing at 10.8% CAGR to 2020 2Biodegradable Plastics Market Growing at 10.8% CAGR to 2020 3Biodegradable Plastics Market Growing at 10.8% CAGR to 2020 4Biodegradable Plastics Market Growing at 10.8% CAGR to 2020 5Mexico Biomedical Sensors Market Report 2015-2020 2
... Engineering News (Volume 26, No. 11) , , ... one's own shop, even for a period longer than a year, ... filed later to protect the invention. , ,This rule was pronounced ... patent asserted that the patent was invalid due to prior public ...
... Wis. - A new combination of technical solutions ... publishing, broadcasting, and graphic design to transfer high-definition video ... joint solution promises Apple Mac OS X users in ... reduce the time demand for specialized data transfer tasks. ...
... the biotech industry? The July 2006 edition of MedAd News ... birthday this year. On Aug, 23, 2004, I wrote an article ... Boston, Geneva, or Chicago? " , ,In this article I reviewed ... that date the industry back to the 1970s and perhaps the ...
Cached Biology Technology:With patents and research tools, when is private really public? 2With patents and research tools, when is private really public? 3With patents and research tools, when is private really public? 4With patents and research tools, when is private really public? 5Small Tree branches out with affordable video 2At 30, biotech is an industry at a crossroads 2At 30, biotech is an industry at a crossroads 3At 30, biotech is an industry at a crossroads 4At 30, biotech is an industry at a crossroads 5At 30, biotech is an industry at a crossroads 6At 30, biotech is an industry at a crossroads 7
(Date:8/24/2015)... August 24, 2015 The consulting company ... largest biometrics manufacturer DERMALOG and its customized solutions and products ... Biometrics Company of the Year Award". DERMALOG is particularly successful ... .   -Cross reference: Picture is available at ... On Thursday evening, in South Africa,s ...
(Date:8/20/2015)... -- NXT-ID, Inc. (NASDAQ: NXTD ) ("NXT-ID" or ... growing mobile commerce market and creator of the Wocket® ... Alliance and the EMV Migration Forum.  ... Alliance Latin America (SCALA) Chapter provides NXT-ID, Inc. direct ... promoting adoption of smart card technology. To ...
(Date:8/17/2015)... Aug. 17, 2015  NXT-ID, Inc. (NASDAQ: NXTD ... focused on the growing mobile commerce market and creator ... campaign for Q4 2015. The new marketing campaign is ... of Amplitude Marketing Group ( http://amplitudemarketing.com/ ) and TPMG ... a leader in retail driven marketing and brand awareness ...
Breaking Biology News(10 mins):Frost & Sullivan Honors DERMALOG with Biometrics Prize for Achievements in Africa 2Frost & Sullivan Honors DERMALOG with Biometrics Prize for Achievements in Africa 3NXT-ID, Inc. Joins Smart Card Alliance and EMV Migration Forum 2NXT-ID, Inc. Joins Smart Card Alliance and EMV Migration Forum 3NXT-ID, Inc. Joins Smart Card Alliance and EMV Migration Forum 4NXT-ID, Inc. Launches Sales Campaign for Wocket Smart Wallet with Award Winning Marketing Team 2NXT-ID, Inc. Launches Sales Campaign for Wocket Smart Wallet with Award Winning Marketing Team 3
... for centuries that copper is a potent weapon against ... serious urinary tract infections "know" this, too, and steal ... them. Blocking this thievery with a drug ... according to researchers at Washington University School of Medicine ...
... Calif.) An evaluation of national data by UC Davis researchers ... higher risk of death. When compared to those with ... risk of death during a follow-up period of six years. People ... if they also had diabetes or hypertension. The findings, ...
... be a breakthrough in the practical application of epigenetic ... that those with osteoarthritis have a signature epigenetic change ... gene that produces a destructive enzyme called MMP13. This ... destruction of joint cartilage, making MMP13 and the epigenetic ...
Cached Biology News:Urinary tract infections steal from hosts' defense arsenals 2UC Davis study finds that above-normal weight alone does not increase the short-term risk of death 2UC Davis study finds that above-normal weight alone does not increase the short-term risk of death 3Scientists discover an epigenetic cause of osteoarthritis 2
UltraMount is formulated for coverslipping sections stained with alcohol soluble chromogens, such as Fast-Red or AEC. No heating is required prior to use. Coverslips may be removed by soaking in wate...
This monoclonal antibody specifically recognizes Y. pestiscapsular F1 antigen. It does not cross-react with Y. pseudotuberculosisor Y. enterocolitica....
... c-Jun proto-oncogene was first identified as the cellular ... Jun B and Jun D have been shown ... C-terminal regions, which are involved in dimerization and ... involved in transcriptional activation, diverge. ...
IHC Zinc Fixative - , 1000 ml Consult technical datasheet for details....
Biology Products: