Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
ABCB4
ABCC1
ABL
AKAP13
AKT1
AKT2
APC
AR
ATM
BAD
BAG1
BAK1 BARD1
BAX
BCL2
BCL3
BCL6
BCR
BRAF
BRCA1
BRCA2
CBL
CCND1
CCNE1
CDH1 CDH13
CDK4
CDKN1A
CDKN1B
CDKN1C
CDKN2A
CDKN3
CHEK1
CHEK2
CRK
CSF1R
DCC
DEK EEF1A2
EGFR
EIF3S3
EIF4E
ELK1
EPHA1
ERBB2
ERBB3
ERBB4
ERG
ESR1
ETS1
ETS2 FES
FGF3
FGF4
FGF6
FGFR1
FGFR2
FGR
FLI1
FOS
FYN
GADD45A
GADD45B
GADD45G GLI
GNAI2
GRO1
HCC-4
HCK
HRAS
JUN
JUND
KAI1
KIT
KRAS2
LCK
MADH2 MADH4
MAF
MAFF
MAS1
MAX
MCF2
MDM2
MEL
MEN1
MET
MLH1
MOS
MPL MSH2
MYB
MYB1
MYC
MYCL1
MYCN
NCOA1
NCOA3
NET1
NF1
NF2
NFKB2
NRAS NTRK1
PAX2
PDGFB
PGR
PIM1
PTCH
PTEN
RAF1
RARA
RB1
REL
RET
ROS1 RPS6KB1
RUNX1
SAS
SKI
SRC
TAL1
TGFBR1
TGFBR2
THRA
TIAM1
TLX1
TNFRSF1B
TNFRSF6 TP53
VAV1
VHL
WNT1
WNT2
WNT5A
WNT7B
WT1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
symbol
Accession # Unigene Target
location
Coding
region
siRNA target %GC
ABCB1
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Cancer siRNA Oligo Set Version

(Date:12/19/2014)... MA (PRWEB) December 18, 2014 Reports ... in the United States suffer from one or more ... asthma, or cancer. Medication can address some of these ... daily activities that many sufferers face. While implanted nerve ... and stimulate the whole nerve, which can induce side ...
(Date:12/19/2014)... The empty capsules market is experiencing growth ... technological innovations in the empty capsules market. The ... growth of the empty capsules market. , Get ... of Report , The report will enrich both ... to gauge the pulse of the market which ...
(Date:12/19/2014)... 18, 2014 Egenix, Inc. is pleased to announce ... of the Board, to succeed Donald Fresne ; Mr. ... continue as a member of the Board.  In recognition of ... the company over almost twenty years, the Board designated Mr. ... Directors has established a Search Committee to find a suitable ...
(Date:12/17/2014)... 2014 The Activated Carbon Manufacturing ... is why IBISWorld updated its original industry research report. ... from an intensified focus on environmental policy. Over the ... standards for power plants and a range of other ... Industry Analyst Sarah Kahn, “a range of downstream industrial ...
Breaking Biology Technology:Draper Wins GSK Funding for Smaller, Smarter Implantable Devices 2Empty Capsules Market Hit to Reach $1,820 Million by 2019 - New Research Report by MarketsandMarkets 2Empty Capsules Market Hit to Reach $1,820 Million by 2019 - New Research Report by MarketsandMarkets 3Empty Capsules Market Hit to Reach $1,820 Million by 2019 - New Research Report by MarketsandMarkets 4Activated Carbon Manufacturing in the US Industry Market Research Report Has Been Updated from IBISWorld 2Activated Carbon Manufacturing in the US Industry Market Research Report Has Been Updated from IBISWorld 3
... Symbol: MS, EDMONTON, May 5 /PRNewswire-FirstCall/ - BioMS ... of multiple sclerosis (MS), will hold,its Annual General Meeting ... 4:00,p.m. (ET)., A live audio webcast of the ... connect at least ten minutes prior to the,conference call ...
... Cequent Pharmaceuticals, a,pioneer in the development of ... and treat human disease, announced that Michael ... of directors. Dr. Taylor is,president and chief ... Massachusetts-based biotechnology company developing novel,classes of therapeutics ...
... Wednesday, May 7th at 9:30am EDT, NEW YORK, ... today announced that Michael S. Weiss, the Company,s,Chairman and ... Bank 33rd Annual Health Care Conference in Boston, Massachusetts., ... Wednesday, May 7th at,9:30am EDT, will be webcast live ...
Cached Biology Technology:BioMS Medical announces conference call and web cast for Annual General Meeting 2Michael D. Taylor, Ph.D., Joins Cequent Pharmaceuticals' Board of Directors 2Keryx Biopharmaceuticals to Present at the Deutsche Bank 33rd Annual Health Care Conference 2
(Date:12/19/2014)... LAS VEGAS , Dec. 18, 2014   ... platform built for the post-password and Internet of Things ... additional seed funding. The venture round was led by ... Pantera Capital, Rimrock Venture Partners, VegasTechFund, and others.  LaunchKey ... the new funding to expand its team and bring ...
(Date:12/17/2014)... , Dec. 15, 2014 The Defense ... it easier to detect and prevent counterfeit microcircuits ... Today the agency started performing an in-house microcircuit ... validate the authenticity of purchased microcircuits while increasing ... quality control measures will be conducted at DLA,s ...
(Date:12/17/2014)... Dec. 16, 2014 Valencell, a leader in ... biometric technology to industry leaders such as Intel, Jabra, ... validated, biometric wearable products. These products will be showcased ... Las Vegas . "Our ... flexible and robust – with the clinical data to ...
Breaking Biology News(10 mins):LaunchKey Raises $3 Million in Additional Funding Led by Metamorphic Ventures 2LaunchKey Raises $3 Million in Additional Funding Led by Metamorphic Ventures 3Defense Logistics Agency Launches DNA Marking Capability to Strengthen Microcircuit Supply Chain 2Defense Logistics Agency Launches DNA Marking Capability to Strengthen Microcircuit Supply Chain 3Valencell PerformTek Biometrics Power the Most Accurate Wearables at CES 2015 2
... mysteries of modern coral reefs is how they evolved from ... in the record of coral evolution. This evolutionary gap ... and changes in the Earth,s climate between 1 and 2 ... went extinct, and the modern reef corals emerged. To ...
... Bioinformatics Laboratory at the University of Illinois in collaboration ... probe the world of proteins for answers to questions ... formed from chains of amino acids and fold into ... sciences professor Gustavo Caetano-Anolls, very little is known about ...
... a new study carried out at the Norwegian Institute of ... supplements from four weeks before conception to eight weeks into ... birth to children with childhood autism (classic autism). "It ... before conception to eight weeks into pregnancy," states Pl Surn, ...
Cached Biology News:University of Miami geologists to address the mystery of an evolution gap in reef corals 2Untangling life's origins 2Untangling life's origins 3Folic acid lowers risk of autism 2
... a cytochrome P450 (CYP450) metabolite postulated to ... and cerebral vasculature. In rat cerebral microvessels, ... autoregulatory vasoconstriction. 20-HETE is excreted mainly as ... 20-HETE (20-40 pg/ml in human urine) is ...
Contact us for more information...
Rabbit polyclonal to Quinaldic Acid ( Abpromise for all tested applications). Antigen: Synthetic peptide Quinaldic Acid conjugated to a protein carrier....
... kinase (JNK) is one of the several ... been used as a sensitive reporter for ... a 1000-fold increase in sensitivity in comparison ... Firefly luciferase catalyzes the oxidative carboxylation of ...
Biology Products: