Navigation Links
Exon


An exon is a nucleic acid sequence that is represented in the mature form of an RNA molecule after a) portions of a precursor RNA, introns, have been removed by cis-splicing or b) two or more precursor RNA molecules have been ligated by trans-splicing. The mature RNA...
Full article >>>

USA. Multi-national group of companies, active in fuels, lubricants, chemicals and polymers for a wide range of consumer, technical and industrial markets. ...
of DNA that codes information for protein synthesis that is transcribed to messenger RNA ... Depending on the context, exon can refer to the ...
Full article >>>

J. James Exon For other uses, see Exon (disambiguation) . J. James Exon United States Senator from Nebraska In office January 3 , 1979
Full article >>>

Definition of exon at Dictionary.com with free online dictionary, pronunciation, ... intron and exon site. prince william sound oil spill. who owns exxon ...
Full article >>>

Encyclopedia article of Exon at Reference.com compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in Duchenne ...
Full article >>>

MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ...
Full article >>>

Amplimer for Exon 2 ... Primers for Exon 3. TrpnT 3F. atgagaacggcaggccaggctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgag ...
Full article >>>

GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...
Full article >>>

Information about exon in the free online English dictionary and encyclopedia. ... exon - sequence of a gene's DNA that transcribes into protein structures; "exons ...
Full article >>>

Exon Biotech Pvt Ltd (EBPL) sets out to be the preferred quality partner in the ... Although committed to aquaculture development and sustainability we strive for ...
Full article >>>

John James "Jim" Exon (August 9, 1921 – June 10, 2005) was an American ... Exon was born in Geddes, South Dakota, in 1921 and attended the University of ...
Full article >>>

About Exon-Intron. Exon-Intron, Inc. is a biotechnology education firm. ... Exon-Intron, Inc. P.O. Box 395. Loganville, PA 17342. Tel: 717-428-3780. Tel: 800-407-6546 ...
Full article >>>

Sun 4 binary: exon. Please report broken links. Alphabetic List of Delila Programs ... Documentation for the exon program is below, with links to related programs in ...
Full article >>>

Encyclopedia article about Exon. Information about Exon in the Columbia Encyclopedia, Computer Desktop Encyclopedia, computing dictionary.
Full article >>>

... the two motifs are conserved in mouse orthologous genes that undergo exon skipping. ... For example, mutations in exon 18 of the breast cancer BRCA1 gene cause ...
Full article >>>

PTB: A REPRESSOR OF EXON DEFINITION. MECHANISMS OF PTB REPRESSION ... The recognition of intron-exon boundaries, the splice sites, however, requires ...
Full article >>>


'"/>


(Date:12/17/2014)... , Dec. 16, 2014 Valencell, a ... its PerformTek biometric technology to industry leaders such as ... accurate, clinically validated, biometric wearable products. These products will ... in Las Vegas . ... is accurate, flexible and robust – with the clinical ...
(Date:12/11/2014)... Research and Markets , ... http://www.researchandmarkets.com/research/twhjll/biometrics_market ) has announced the addition of the ...  report to their offering. One ... in technology. With continuous advances in technology, it ... latest standard that meets the needs and expectations ...
(Date:12/10/2014)... You,ve been here before: you desperately need to sign into ... key or the answer to your secret question. What,s your ... Today, Hoyos Labs , a digital infrastructure security ... an end to the frustration that comes with usernames, passwords ... a user,s smartphone to acquire his or her biometrics to ...
Breaking Biology News(10 mins):Valencell PerformTek Biometrics Power the Most Accurate Wearables at CES 2015 2Biometrics Market in the APAC Region 2015-2019: Key Vendors are 3M Cogent, NEC, Safran and Suprema 2The Password is Finally Dead: Launch of 1U Mobile App Eliminates Need for All Usernames and Passwords 2The Password is Finally Dead: Launch of 1U Mobile App Eliminates Need for All Usernames and Passwords 3
... half the world,s population lives in areas at risk of ... bites from mosquitoes, and each year causes hundreds of thousands ... United States. The malaria-causing parasite, Plasmodium falciparum ... which feeds on human blood. P. falciparum ...
... is arguably the most impressive feat of nature, where ... building blocks of life at fantastically high efficiency. Indeed ... plants for food, shelter and clothing. While ... fascinating process by which plants store solar energy as ...
... November 3, 2010 -- The latest discoveries and innovations ... will be presented this month at a major scientific ... hearing aids, new technologies for monitoring fetal heartbeats, intriguing ... into the social lives of dolphins. The 2nd ...
Cached Biology News:UC Riverside cell biologist to investigate how malaria parasite multiplies in red blood cells 2The developmental dynamics of the maize leaf transcriptome 2Highlights from major acoustical science and technology conference, Nov. 15-19 2Highlights from major acoustical science and technology conference, Nov. 15-19 3Highlights from major acoustical science and technology conference, Nov. 15-19 4Highlights from major acoustical science and technology conference, Nov. 15-19 5Highlights from major acoustical science and technology conference, Nov. 15-19 6Highlights from major acoustical science and technology conference, Nov. 15-19 7Highlights from major acoustical science and technology conference, Nov. 15-19 8Highlights from major acoustical science and technology conference, Nov. 15-19 9Highlights from major acoustical science and technology conference, Nov. 15-19 10Highlights from major acoustical science and technology conference, Nov. 15-19 11Highlights from major acoustical science and technology conference, Nov. 15-19 12Highlights from major acoustical science and technology conference, Nov. 15-19 13
Other biology dictionary