Navigation Links
Exon


An exon is a nucleic acid sequence that is represented in the mature form of an RNA molecule after a) portions of a precursor RNA, introns, have been removed by cis-splicing or b) two or more precursor RNA molecules have been ligated by trans-splicing. The mature RNA...
Full article >>>

USA. Multi-national group of companies, active in fuels, lubricants, chemicals and polymers for a wide range of consumer, technical and industrial markets. ...
of DNA that codes information for protein synthesis that is transcribed to messenger RNA ... Depending on the context, exon can refer to the ...
Full article >>>

J. James Exon For other uses, see Exon (disambiguation) . J. James Exon United States Senator from Nebraska In office January 3 , 1979
Full article >>>

Definition of exon at Dictionary.com with free online dictionary, pronunciation, ... intron and exon site. prince william sound oil spill. who owns exxon ...
Full article >>>

Encyclopedia article of Exon at Reference.com compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in Duchenne ...
Full article >>>

MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ...
Full article >>>

Amplimer for Exon 2 ... Primers for Exon 3. TrpnT 3F. atgagaacggcaggccaggctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgag ...
Full article >>>

GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...
Full article >>>

Information about exon in the free online English dictionary and encyclopedia. ... exon - sequence of a gene's DNA that transcribes into protein structures; "exons ...
Full article >>>

Exon Biotech Pvt Ltd (EBPL) sets out to be the preferred quality partner in the ... Although committed to aquaculture development and sustainability we strive for ...
Full article >>>

John James "Jim" Exon (August 9, 1921 – June 10, 2005) was an American ... Exon was born in Geddes, South Dakota, in 1921 and attended the University of ...
Full article >>>

About Exon-Intron. Exon-Intron, Inc. is a biotechnology education firm. ... Exon-Intron, Inc. P.O. Box 395. Loganville, PA 17342. Tel: 717-428-3780. Tel: 800-407-6546 ...
Full article >>>

Sun 4 binary: exon. Please report broken links. Alphabetic List of Delila Programs ... Documentation for the exon program is below, with links to related programs in ...
Full article >>>

Encyclopedia article about Exon. Information about Exon in the Columbia Encyclopedia, Computer Desktop Encyclopedia, computing dictionary.
Full article >>>

... the two motifs are conserved in mouse orthologous genes that undergo exon skipping. ... For example, mutations in exon 18 of the breast cancer BRCA1 gene cause ...
Full article >>>

PTB: A REPRESSOR OF EXON DEFINITION. MECHANISMS OF PTB REPRESSION ... The recognition of intron-exon boundaries, the splice sites, however, requires ...
Full article >>>


'"/>


(Date:7/10/2014)... the Straits of Mackinac reverse direction every few days, ... would quickly contaminate shorelines miles away in both lakes ... Michigan study commissioned by the National Wildlife Federation. , ... animations, oil from a hypothetical pipeline break reached Mackinac ... Blanc Island after two days. All three islands are ...
(Date:7/10/2014)... The yellow crazy ant Anoplolepis gracilipes is ranked ... responsible for catastrophic ecological impacts on islands. A new study ... examines and assesses the effects and dangers of the ... of the mature palm forest of the Valle de Mai, ... palm forest of Valle de Mai is a unique ecosystem ...
(Date:7/10/2014)... Columbia University Medical Center (CUMC) researchers have created a ... retinitis pigmentosa (RP), a leading cause of vision loss. ... of induced pluripotent stem (iPS) cell technology to transform ... as a patient-specific model for disease study and preclinical ... H. Tsang, MD, PhD, showed that a form of ...
Breaking Biology News(10 mins):Straits of Mackinac 'worst possible place' for a Great Lakes oil spill 2Straits of Mackinac 'worst possible place' for a Great Lakes oil spill 3Invasion of yellow crazy ant in a Seychelles UNESCO palm forest: Threats and solutions 2Patient-specific stem cells and personalized gene therapy 2Patient-specific stem cells and personalized gene therapy 3
... of proteins and other chemicals that underlies most ... molecules that accelerate chemical reactions between molecules. The ... the synthesis of chemicals and pharmaceuticals, devise new ... therapies. In the August 16 issue of ...
... has journeyed to this section of Antarcticas Amundsen Sea, but ... researchers and a Boerne High School science teacher will join ... sail on a two month expedition. The trip, ... to UTSA, is designed to study the relationship of sea ...
... evidence reported in the August issue of Cell Stem Cell, ... how the HIV/AIDS virus leads to learning and memory deficits, ... the surface of the virus not only kills some mature ... prevents the birth of new brain cells by crippling adult ...
Cached Biology News:MGH researchers describe new way to identify, evolve novel enzymes 2Texas researchers and educators head for Antarctica 2HIV is a 'double hit' to the brain 2
Other biology dictionary