Navigation Links
Exon


An exon is a nucleic acid sequence that is represented in the mature form of an RNA molecule after a) portions of a precursor RNA, introns, have been removed by cis-splicing or b) two or more precursor RNA molecules have been ligated by trans-splicing. The mature RNA...
Full article >>>

USA. Multi-national group of companies, active in fuels, lubricants, chemicals and polymers for a wide range of consumer, technical and industrial markets. ...
of DNA that codes information for protein synthesis that is transcribed to messenger RNA ... Depending on the context, exon can refer to the ...
Full article >>>

J. James Exon For other uses, see Exon (disambiguation) . J. James Exon United States Senator from Nebraska In office January 3 , 1979
Full article >>>

Definition of exon at Dictionary.com with free online dictionary, pronunciation, ... intron and exon site. prince william sound oil spill. who owns exxon ...
Full article >>>

Encyclopedia article of Exon at Reference.com compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in Duchenne ...
Full article >>>

MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ...
Full article >>>

Amplimer for Exon 2 ... Primers for Exon 3. TrpnT 3F. atgagaacggcaggccaggctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgag ...
Full article >>>

GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...
Full article >>>

Information about exon in the free online English dictionary and encyclopedia. ... exon - sequence of a gene's DNA that transcribes into protein structures; "exons ...
Full article >>>

Exon Biotech Pvt Ltd (EBPL) sets out to be the preferred quality partner in the ... Although committed to aquaculture development and sustainability we strive for ...
Full article >>>

John James "Jim" Exon (August 9, 1921 – June 10, 2005) was an American ... Exon was born in Geddes, South Dakota, in 1921 and attended the University of ...
Full article >>>

About Exon-Intron. Exon-Intron, Inc. is a biotechnology education firm. ... Exon-Intron, Inc. P.O. Box 395. Loganville, PA 17342. Tel: 717-428-3780. Tel: 800-407-6546 ...
Full article >>>

Sun 4 binary: exon. Please report broken links. Alphabetic List of Delila Programs ... Documentation for the exon program is below, with links to related programs in ...
Full article >>>

Encyclopedia article about Exon. Information about Exon in the Columbia Encyclopedia, Computer Desktop Encyclopedia, computing dictionary.
Full article >>>

... the two motifs are conserved in mouse orthologous genes that undergo exon skipping. ... For example, mutations in exon 18 of the breast cancer BRCA1 gene cause ...
Full article >>>

PTB: A REPRESSOR OF EXON DEFINITION. MECHANISMS OF PTB REPRESSION ... The recognition of intron-exon boundaries, the splice sites, however, requires ...
Full article >>>


'"/>


(Date:7/30/2014)... Washington, DCToday scientists unveiled the first high-resolution map ... the entire country of Per. The new and ... a sea change for future market-based carbon economies. ... extremely high ecological diversity and it provides the ... degradation for conservation, land use, and enforcement purposes. ...
(Date:7/29/2014)... in the University of Bristol,s Nutrition and Behaviour Unit ... into account when planning meals. , The research, to ... Ingestive Behavior Conference (SSIB 2014) in Seattle, USA this ... do. , The team was led by Professor Jeff ... Psychology. , As part of a Biotechnology and Biological ...
(Date:7/29/2014)... warms and sea ice retreats, the North is changing. ... open water which is predicted to extend across the ... Storms thus have the potential to create Arctic swell ... unpredictable element to the region. , A University of Washington ... middle of the Arctic Ocean, and detected house-sized waves ...
Breaking Biology News(10 mins):Peru's carbon quantified: Economic and conservation boon 2Peru's carbon quantified: Economic and conservation boon 3Huge waves measured for first time in Arctic Ocean 2Huge waves measured for first time in Arctic Ocean 3
... GEOLOGY ends 2012 with 23 new articles spanning ... Naica Cave, Mexico; Diamantina, Brazil; the Galpagos hotspot; China; ... central West Greenland; the California arc; the Pacific Ring ... Sierra Nevada; Spain; New Zealand; Turkey; Connecticut, USA; and ...
... the extinct giant piranha, or megapiranha, have the most ... body size is taken into account, finds researchers in ... The research paper, Mega-Bites: Extreme jaw forces of living ... which allows them to attack and bite chunks out ...
... RICHLAND, Wash. Pacific Northwest National Laboratory has been ... large amounts of renewable energy until it,s needed, fight ... to the marketplace. The Federal Laboratory Consortium announced ... Richland is receiving three 2013 Excellence in Technology Transfer ...
Cached Biology News:GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 2GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 3GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 4GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 5GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 6GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 7GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 8GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 9GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 10GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 11GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 12GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 13GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 14GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 15GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 16GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 17GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 18GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 19GEOLOGY returns to Naica Cave, Mexico, and extends its reach to Mercury 20Black piranha, megapiranha have most powerful bites of fish living or extinct, finds GW researcher 2PNNL recognized for transferring innovations to the marketplace 2PNNL recognized for transferring innovations to the marketplace 3
Other biology dictionary