Navigation Links
Exon


An exon is a nucleic acid sequence that is represented in the mature form of an RNA molecule after a) portions of a precursor RNA, introns, have been removed by cis-splicing or b) two or more precursor RNA molecules have been ligated by trans-splicing. The mature RNA...
Full article >>>

USA. Multi-national group of companies, active in fuels, lubricants, chemicals and polymers for a wide range of consumer, technical and industrial markets. ...
of DNA that codes information for protein synthesis that is transcribed to messenger RNA ... Depending on the context, exon can refer to the ...
Full article >>>

J. James Exon For other uses, see Exon (disambiguation) . J. James Exon United States Senator from Nebraska In office January 3 , 1979
Full article >>>

Definition of exon at Dictionary.com with free online dictionary, pronunciation, ... intron and exon site. prince william sound oil spill. who owns exxon ...
Full article >>>

Encyclopedia article of Exon at Reference.com compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in Duchenne ...
Full article >>>

MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ...
Full article >>>

Amplimer for Exon 2 ... Primers for Exon 3. TrpnT 3F. atgagaacggcaggccaggctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgag ...
Full article >>>

GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...
Full article >>>

Information about exon in the free online English dictionary and encyclopedia. ... exon - sequence of a gene's DNA that transcribes into protein structures; "exons ...
Full article >>>

Exon Biotech Pvt Ltd (EBPL) sets out to be the preferred quality partner in the ... Although committed to aquaculture development and sustainability we strive for ...
Full article >>>

John James "Jim" Exon (August 9, 1921 – June 10, 2005) was an American ... Exon was born in Geddes, South Dakota, in 1921 and attended the University of ...
Full article >>>

About Exon-Intron. Exon-Intron, Inc. is a biotechnology education firm. ... Exon-Intron, Inc. P.O. Box 395. Loganville, PA 17342. Tel: 717-428-3780. Tel: 800-407-6546 ...
Full article >>>

Sun 4 binary: exon. Please report broken links. Alphabetic List of Delila Programs ... Documentation for the exon program is below, with links to related programs in ...
Full article >>>

Encyclopedia article about Exon. Information about Exon in the Columbia Encyclopedia, Computer Desktop Encyclopedia, computing dictionary.
Full article >>>

... the two motifs are conserved in mouse orthologous genes that undergo exon skipping. ... For example, mutations in exon 18 of the breast cancer BRCA1 gene cause ...
Full article >>>

PTB: A REPRESSOR OF EXON DEFINITION. MECHANISMS OF PTB REPRESSION ... The recognition of intron-exon boundaries, the splice sites, however, requires ...
Full article >>>


'"/>


See more about: Exon

TAG: Exon
(Date:11/26/2009)...ies has shown that closing schools in the event of...ficant role in reducing illness transmission. Rese...fectious Diseases compared opportunities for infe...g that they were reduced when schools are shut. ,...Belgium, led a team of European researchers in usi...
(Date:11/25/2009)...ay be used to boost resistance to, or slow, the de...edicine researchers report in a study published in..., Parkinson,s disease is caused by a degeneratio...nown as the substantia nigra, which is responsible...opamine in late-stage Parkinson,s causes symptoms ...
(Date:11/25/2009)...s some 250 million liters of blood through the bod...he heart have to be extremely durable. The researc...ir of the Department of Medicine III at Heidelberg...tus), has discovered a protein that is responsible...the sarcomere. In cooperation with other researche...
Breaking Biology News(10 mins):School closure could reduce swine flu transmission by 21 percent 2Hormone ghrelin can boost resistance to Parkinson's disease 2New genetic cause of cardiac failure discovered 2Data Show Medication Adherence is an Important Factor in the Treatment of Postmenopausal Osteoporosis 4984 1Data Show Medication Adherence is an Important Factor in the Treatment of Postmenopausal Osteoporosis 4984 2Data Show Medication Adherence is an Important Factor in the Treatment of Postmenopausal Osteoporosis 4984 3Data Show Medication Adherence is an Important Factor in the Treatment of Postmenopausal Osteoporosis 4984 4Data Show Medication Adherence is an Important Factor in the Treatment of Postmenopausal Osteoporosis 4984 5Data Show Medication Adherence is an Important Factor in the Treatment of Postmenopausal Osteoporosis 4984 6Data Show Medication Adherence is an Important Factor in the Treatment of Postmenopausal Osteoporosis 4984 7Data Show Medication Adherence is an Important Factor in the Treatment of Postmenopausal Osteoporosis 4984 8Data Show Medication Adherence is an Important Factor in the Treatment of Postmenopausal Osteoporosis 4984 9GENova appoints Dr Philip Gould to Scientific Advisory Board 56991 1GENova appoints Dr Philip Gould to Scientific Advisory Board 56991 2GENova appoints Dr Philip Gould to Scientific Advisory Board 56991 3Opto electronic nose sniffs out toxic gases 9902 1Opto electronic nose sniffs out toxic gases 9902 2Opto electronic nose sniffs out toxic gases 9902 3
...ghting like a girl or fighting like a boy is hardw...in the Nov. 19 Nature Neuroscience advance online ...l School and the Institute of Molecular Pathology ...s "fruitless" is a key factor underlying sexual di...ne in an unlikely new animal model for understandi...
...e Shoklo Malaria Research Unit (SMRU), Thailand, w...28 December entitled "Twenty Years of Malaria Rese...nationally-renowned experts and featuring talks an...a, from epidemiology to therapeutics and from immu...Research Unit (SMRU) in Mae Sot, Thailand, which b...
...searchers at the Albert Einstein College of Medici...n grant from the National Cancer Institute to stud...t with surrounding tissues, cells and chemicals in... invade other areas of the body in the process kno...ohn Condeelis, co-chair of anatomy and structural ...
Other Biology News:Fighting like a girl or boy determined by gene in fruit flies 2Fighting like a girl or boy determined by gene in fruit flies 3Twenty Years of Malaria Research: Outcomes and Perspectives 2World's smallest cancer detection device 2
Other biology dictionary