Navigation Links
Exon


An exon is a nucleic acid sequence that is represented in the mature form of an RNA molecule after a) portions of a precursor RNA, introns, have been removed by cis-splicing or b) two or more precursor RNA molecules have been ligated by trans-splicing. The mature RNA...
Full article >>>

USA. Multi-national group of companies, active in fuels, lubricants, chemicals and polymers for a wide range of consumer, technical and industrial markets. ...
of DNA that codes information for protein synthesis that is transcribed to messenger RNA ... Depending on the context, exon can refer to the ...
Full article >>>

J. James Exon For other uses, see Exon (disambiguation) . J. James Exon United States Senator from Nebraska In office January 3 , 1979
Full article >>>

Definition of exon at Dictionary.com with free online dictionary, pronunciation, ... intron and exon site. prince william sound oil spill. who owns exxon ...
Full article >>>

Encyclopedia article of Exon at Reference.com compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in Duchenne ...
Full article >>>

MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ...
Full article >>>

Amplimer for Exon 2 ... Primers for Exon 3. TrpnT 3F. atgagaacggcaggccaggctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgag ...
Full article >>>

GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...
Full article >>>

Information about exon in the free online English dictionary and encyclopedia. ... exon - sequence of a gene's DNA that transcribes into protein structures; "exons ...
Full article >>>

Exon Biotech Pvt Ltd (EBPL) sets out to be the preferred quality partner in the ... Although committed to aquaculture development and sustainability we strive for ...
Full article >>>

John James "Jim" Exon (August 9, 1921 – June 10, 2005) was an American ... Exon was born in Geddes, South Dakota, in 1921 and attended the University of ...
Full article >>>

About Exon-Intron. Exon-Intron, Inc. is a biotechnology education firm. ... Exon-Intron, Inc. P.O. Box 395. Loganville, PA 17342. Tel: 717-428-3780. Tel: 800-407-6546 ...
Full article >>>

Sun 4 binary: exon. Please report broken links. Alphabetic List of Delila Programs ... Documentation for the exon program is below, with links to related programs in ...
Full article >>>

Encyclopedia article about Exon. Information about Exon in the Columbia Encyclopedia, Computer Desktop Encyclopedia, computing dictionary.
Full article >>>

... the two motifs are conserved in mouse orthologous genes that undergo exon skipping. ... For example, mutations in exon 18 of the breast cancer BRCA1 gene cause ...
Full article >>>

PTB: A REPRESSOR OF EXON DEFINITION. MECHANISMS OF PTB REPRESSION ... The recognition of intron-exon boundaries, the splice sites, however, requires ...
Full article >>>


'"/>


(Date:10/14/2014)... A Mount Sinai-led research team has discovered a new kind ... or a cell that lines liver blood vessels, according to ... Reports . The existence of such a cell type contradicts ... the embryo, and may hold clues to origins of, and ... develop from a single cell into a complex being made ...
(Date:10/14/2014)... – A team of scientists led by researchers ... and the University of Miami Miller School of ... key genetic pathway underlying bipolar (manic depressive) disorder, ... for treating bipolar affective disorder, as well as ... new findings, published online this week in Nature ...
(Date:10/14/2014)... PA, October 14, 2014 – Over the past decades, ... of institutions to meet the needs of infants for ... of these infants to thrive. , Infancy ... development of the cortex. A generation of research suggests ... promote cortical development and cognitive function. In contrast, deprivation ...
Breaking Biology News(10 mins):Stem cell discovery challenges dogma on how fetus develops; holds insights for liver cancer and reg 2Stem cell discovery challenges dogma on how fetus develops; holds insights for liver cancer and reg 3Rare genetic disease protects against bipolar disorder 2Rare genetic disease protects against bipolar disorder 3Institutional rearing may increase risk attention-deficit disorder 2
... clear skies and smooth sailing for oceanic vessels has ... to air pollution and greenhouse gas emissions that impact ... James Winebrake and James Corbett examines "Emission Tradeoffs among ... Oil, Marine Gas Oil, and Marine Diesel Oil," in ...
... The 2009 Force Protection Equipment,Demonstration (FPED VII) will ... and Marine Corps Base, Quantico, VA, next May ... War on Terror., The demonstration is the ... commercial off-the-shelf equipment solutions to current,and evolving force ...
... new paper by a team of researchers led by ... the University of Notre Dame, provides important new insights ... wall. The cell wall is a critically important ... is a rigid entity encasing the bacterium, and antibiotics ...
Cached Biology News:Fuel emissions from marine vessels remain a global concern 22009 Force Protection Equipment Demonstration Set for Next May 19-21 2
Other biology dictionary