Navigation Links
Exon


An exon is a nucleic acid sequence that is represented in the mature form of an RNA molecule after a) portions of a precursor RNA, introns, have been removed by cis-splicing or b) two or more precursor RNA molecules have been ligated by trans-splicing. The mature RNA...
Full article >>>

USA. Multi-national group of companies, active in fuels, lubricants, chemicals and polymers for a wide range of consumer, technical and industrial markets. ...
of DNA that codes information for protein synthesis that is transcribed to messenger RNA ... Depending on the context, exon can refer to the ...
Full article >>>

J. James Exon For other uses, see Exon (disambiguation) . J. James Exon United States Senator from Nebraska In office January 3 , 1979
Full article >>>

Definition of exon at Dictionary.com with free online dictionary, pronunciation, ... intron and exon site. prince william sound oil spill. who owns exxon ...
Full article >>>

Encyclopedia article of Exon at Reference.com compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in Duchenne ...
Full article >>>

MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ...
Full article >>>

Amplimer for Exon 2 ... Primers for Exon 3. TrpnT 3F. atgagaacggcaggccaggctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgag ...
Full article >>>

GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...
Full article >>>

Information about exon in the free online English dictionary and encyclopedia. ... exon - sequence of a gene's DNA that transcribes into protein structures; "exons ...
Full article >>>

Exon Biotech Pvt Ltd (EBPL) sets out to be the preferred quality partner in the ... Although committed to aquaculture development and sustainability we strive for ...
Full article >>>

John James "Jim" Exon (August 9, 1921 – June 10, 2005) was an American ... Exon was born in Geddes, South Dakota, in 1921 and attended the University of ...
Full article >>>

About Exon-Intron. Exon-Intron, Inc. is a biotechnology education firm. ... Exon-Intron, Inc. P.O. Box 395. Loganville, PA 17342. Tel: 717-428-3780. Tel: 800-407-6546 ...
Full article >>>

Sun 4 binary: exon. Please report broken links. Alphabetic List of Delila Programs ... Documentation for the exon program is below, with links to related programs in ...
Full article >>>

Encyclopedia article about Exon. Information about Exon in the Columbia Encyclopedia, Computer Desktop Encyclopedia, computing dictionary.
Full article >>>

... the two motifs are conserved in mouse orthologous genes that undergo exon skipping. ... For example, mutations in exon 18 of the breast cancer BRCA1 gene cause ...
Full article >>>

PTB: A REPRESSOR OF EXON DEFINITION. MECHANISMS OF PTB REPRESSION ... The recognition of intron-exon boundaries, the splice sites, however, requires ...
Full article >>>


'"/>


(Date:10/16/2014)... NXT-ID, Inc. (NASDAQ: NXTD ... company focused on the growing mobile commerce market announces ... the Smart Wallet, at the 13 th annual ... global conference on the intersection of technology and the ... , founder and publisher of the Strategic News Service™, ...
(Date:10/15/2014)... spreading rapidly and to an unexpected extent. The outbreak ... and the virus shows a new disease dynamic in ... this reason, the German National Academy of Sciences Leopoldina, ... and the Union of the German Academies of Sciences ... epidemic today. , In the statement the academies call ...
(Date:10/14/2014)... thieves, prostate cancer tumors scavenge and hoard copper that ... avarice may be a fatal weakness. , Researchers ... prostate cancer cells by delivering a trove of copper ... cells brimming with the mineral, leaving non-cancer cells healthy. ... commercially available for other uses, could soon be tested ...
Breaking Biology News(10 mins):NXT-ID Inc. to Present at 13th Annual FiRe Conference 2NXT-ID Inc. to Present at 13th Annual FiRe Conference 3Academies call for consequences from the Ebola virus epidemic 2Academies call for consequences from the Ebola virus epidemic 3Academies call for consequences from the Ebola virus epidemic 4Academies call for consequences from the Ebola virus epidemic 5Prostate cancer's penchant for copper may be a fatal flaw 2
... , April 27 Tyco International Ltd. (NYSE: ... of its Electrical & Metal Products business. Tyco expects to file documents ... months and to complete the proposed transaction in the first half of ... traded U.S. company. , , ...
... , April 27 The Breema Center today ... Germany the 12-16 of May, 2010. Breema is a ... emphasizes the mind-body connection.  The Intensive program is designed to ... long time students deepen their understanding of Breema and its ...
... Debt advice specialists at MoneySolve believe that the record level of personal ... of financial management and debt education. , ... More than 134,000 people became insolvent during 2009, by entering ... to experience severe financial difficulties. Experts at MoneySolve believe that by increasing ...
Cached Biology News:Tyco International To Pursue Spin-Off of Electrical & Metal Products Business 2Tyco International To Pursue Spin-Off of Electrical & Metal Products Business 3Breema Center to Host International Intensive Week in Buhl, Germany 2Breema Center to Host International Intensive Week in Buhl, Germany 3
Other biology dictionary