Navigation Links
Exon


An exon is a nucleic acid sequence that is represented in the mature form of an RNA molecule after a) portions of a precursor RNA, introns, have been removed by cis-splicing or b) two or more precursor RNA molecules have been ligated by trans-splicing. The mature RNA...
Full article >>>

USA. Multi-national group of companies, active in fuels, lubricants, chemicals and polymers for a wide range of consumer, technical and industrial markets. ...
of DNA that codes information for protein synthesis that is transcribed to messenger RNA ... Depending on the context, exon can refer to the ...
Full article >>>

J. James Exon For other uses, see Exon (disambiguation) . J. James Exon United States Senator from Nebraska In office January 3 , 1979
Full article >>>

Definition of exon at Dictionary.com with free online dictionary, pronunciation, ... intron and exon site. prince william sound oil spill. who owns exxon ...
Full article >>>

Encyclopedia article of Exon at Reference.com compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in Duchenne ...
Full article >>>

MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ...
Full article >>>

Amplimer for Exon 2 ... Primers for Exon 3. TrpnT 3F. atgagaacggcaggccaggctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgag ...
Full article >>>

GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...
Full article >>>

Information about exon in the free online English dictionary and encyclopedia. ... exon - sequence of a gene's DNA that transcribes into protein structures; "exons ...
Full article >>>

Exon Biotech Pvt Ltd (EBPL) sets out to be the preferred quality partner in the ... Although committed to aquaculture development and sustainability we strive for ...
Full article >>>

John James "Jim" Exon (August 9, 1921 – June 10, 2005) was an American ... Exon was born in Geddes, South Dakota, in 1921 and attended the University of ...
Full article >>>

About Exon-Intron. Exon-Intron, Inc. is a biotechnology education firm. ... Exon-Intron, Inc. P.O. Box 395. Loganville, PA 17342. Tel: 717-428-3780. Tel: 800-407-6546 ...
Full article >>>

Sun 4 binary: exon. Please report broken links. Alphabetic List of Delila Programs ... Documentation for the exon program is below, with links to related programs in ...
Full article >>>

Encyclopedia article about Exon. Information about Exon in the Columbia Encyclopedia, Computer Desktop Encyclopedia, computing dictionary.
Full article >>>

... the two motifs are conserved in mouse orthologous genes that undergo exon skipping. ... For example, mutations in exon 18 of the breast cancer BRCA1 gene cause ...
Full article >>>

PTB: A REPRESSOR OF EXON DEFINITION. MECHANISMS OF PTB REPRESSION ... The recognition of intron-exon boundaries, the splice sites, however, requires ...
Full article >>>


'"/>


(Date:6/18/2013)... internationally recognized feline experts including veterinarians and feline scientists ... Lincoln, U.K. and Dr Ilona Rodan, Director of Cat ... Society of Feline Medicine (ISFM) and the American Association ... owners and those working with cats on how to ... new guidelines appear in the Journal of Feline ...
(Date:6/17/2013)... Boston, MA Women in the U.S. exposed to high ... as likely to have a child with autism as women ... new study from Harvard School of Public Health (HSPH). It ... autism and air pollution across the U.S. , "Our findings ... of the women in our study lived in areas where ...
(Date:6/17/2013)... a new virus in patients with severe brain infections ... the virus is responsible for the symptoms of disease. ... 28 out of 644 patients with severe brain infections ... in any of the 122 patients with non-infectious brain ... and central nervous system are often fatal and patients ...
Breaking Biology News(10 mins):Feline behavior experts release guidelines to improve the welfare of cats 2Exposure to high pollution levels during pregnancy may increase risk of having child with autism 2New virus isolated from patients with severe brain infections 2New virus isolated from patients with severe brain infections 3
... University scientist Darla Goeres knows that there is more than one ... make sure that when a product claims it kills "99 percent" ... the extremely common communities of bacteria that form on most wet ... on streamside rocks to the sludge that clogs pipes. ...
... biochemists are now able to access 3D images ... than relying on text to provide the understanding ... now provides a new resource by linking written ... resource, first described in BioMed Central,s open access ...
... Researchers at Sheffield University and the University of St. Andrews, ... of information may or may not easily cause a recollection ... find, is in the way in which the learned information ... open-access journal PLoS Computational Biology . When one ...
Cached Biology News:MSU biofilms research helps set standards for everyday products 2
Other biology dictionary