Navigation Links
Exon


An exon is a nucleic acid sequence that is represented in the mature form of an RNA molecule after a) portions of a precursor RNA, introns, have been removed by cis-splicing or b) two or more precursor RNA molecules have been ligated by trans-splicing. The mature RNA...
Full article >>>

USA. Multi-national group of companies, active in fuels, lubricants, chemicals and polymers for a wide range of consumer, technical and industrial markets. ...
of DNA that codes information for protein synthesis that is transcribed to messenger RNA ... Depending on the context, exon can refer to the ...
Full article >>>

J. James Exon For other uses, see Exon (disambiguation) . J. James Exon United States Senator from Nebraska In office January 3 , 1979
Full article >>>

Definition of exon at Dictionary.com with free online dictionary, pronunciation, ... intron and exon site. prince william sound oil spill. who owns exxon ...
Full article >>>

Encyclopedia article of Exon at Reference.com compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in Duchenne ...
Full article >>>

MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ...
Full article >>>

Amplimer for Exon 2 ... Primers for Exon 3. TrpnT 3F. atgagaacggcaggccaggctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgag ...
Full article >>>

GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...
Full article >>>

Information about exon in the free online English dictionary and encyclopedia. ... exon - sequence of a gene's DNA that transcribes into protein structures; "exons ...
Full article >>>

Exon Biotech Pvt Ltd (EBPL) sets out to be the preferred quality partner in the ... Although committed to aquaculture development and sustainability we strive for ...
Full article >>>

John James "Jim" Exon (August 9, 1921 – June 10, 2005) was an American ... Exon was born in Geddes, South Dakota, in 1921 and attended the University of ...
Full article >>>

About Exon-Intron. Exon-Intron, Inc. is a biotechnology education firm. ... Exon-Intron, Inc. P.O. Box 395. Loganville, PA 17342. Tel: 717-428-3780. Tel: 800-407-6546 ...
Full article >>>

Sun 4 binary: exon. Please report broken links. Alphabetic List of Delila Programs ... Documentation for the exon program is below, with links to related programs in ...
Full article >>>

Encyclopedia article about Exon. Information about Exon in the Columbia Encyclopedia, Computer Desktop Encyclopedia, computing dictionary.
Full article >>>

... the two motifs are conserved in mouse orthologous genes that undergo exon skipping. ... For example, mutations in exon 18 of the breast cancer BRCA1 gene cause ...
Full article >>>

PTB: A REPRESSOR OF EXON DEFINITION. MECHANISMS OF PTB REPRESSION ... The recognition of intron-exon boundaries, the splice sites, however, requires ...
Full article >>>


'"/>


(Date:12/10/2014)... Dec. 08, 2014 Research and Markets ... of the "Biometrics Market in Japan 2014-2018" ... http://photos.prnewswire.com/prnh/20130307/600769 The integration ... as rural banking and upgradation of the driver,s ... in the market. Besides the aforementioned projects, biometrics ...
(Date:12/4/2014)... , Dec. 3, 2014  Crossmatch™, a ... announced that its DigitalPersona ® Pro Enterprise ... have been deployed throughout First Bank branch locations ... South Carolina and Virginia. First Bank, ... Southern Pines, North Carolina , selected ...
(Date:11/21/2014)... -- Earlier this year Donald Spector , Chairman of ... the most prolific inventors in the world, got a ... to third party agencies. Spector envisioned this technology even ... earliest known patents in this area. Now major technology ... care, elder care and hospital applications. This technology has ...
Breaking Biology News(10 mins):Biometrics Market in Japan 2014-2018: Key Vendors are DDS, Fujitsu, Hitachi and NEC 2First Bank Partners with Crossmatch to Increase Log In Security 2First Bank Partners with Crossmatch to Increase Log In Security 3Patented Biosensor Wearable Technology Provides a More Civilized Method of Quarantine 2Patented Biosensor Wearable Technology Provides a More Civilized Method of Quarantine 3Patented Biosensor Wearable Technology Provides a More Civilized Method of Quarantine 4
... (BMC) and Boston University School of Public Health (BUSPH) ... at home are less likely to receive colorectal cancer ... English at home. The findings, which currently appear on-line ... patient-provider language barriers play a role in health-care disparities, ...
... to Secretary Kathleen Sebelius at the U.S. Department of ... called out 10 specific challenges to proposed modifications to ... on behalf of its membership of 4,000 informatics professionals, ... of Proposed Rulemaking (NPRM) on HIPAA modifications, along with ...
... frigatebird may be the least likely animal on the ... turns out the Galapagos population of this tropical seabird ... new conservation status, according to a paper by researchers ... Museum of Natural History and the University of Missouri-St. ...
Cached Biology News:Study finds language barriers may play role in health care disparities 2AMIA cites concerns about proposed HIPAA modifications 2AMIA cites concerns about proposed HIPAA modifications 3AMIA cites concerns about proposed HIPAA modifications 4Smithsonian researchers find differences between Galapagos and mainland frigatebirds 2
Other biology dictionary