Navigation Links

An exon is a nucleic acid sequence that is represented in the mature form of an RNA molecule after a) portions of a precursor RNA, introns, have been removed by cis-splicing or b) two or more precursor RNA molecules have been ligated by trans-splicing. The mature RNA...
Full article >>>

USA. Multi-national group of companies, active in fuels, lubricants, chemicals and polymers for a wide range of consumer, technical and industrial markets. ...
of DNA that codes information for protein synthesis that is transcribed to messenger RNA ... Depending on the context, exon can refer to the ...
Full article >>>

J. James Exon For other uses, see Exon (disambiguation) . J. James Exon United States Senator from Nebraska In office January 3 , 1979
Full article >>>

Definition of exon at with free online dictionary, pronunciation, ... intron and exon site. prince william sound oil spill. who owns exxon ...
Full article >>>

Encyclopedia article of Exon at compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in Duchenne ...
Full article >>>

MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ...
Full article >>>

Amplimer for Exon 2 ... Primers for Exon 3. TrpnT 3F. atgagaacggcaggccaggctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctgaagcagaggctgagaccgag ...
Full article >>>

GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ...
Full article >>>

Information about exon in the free online English dictionary and encyclopedia. ... exon - sequence of a gene's DNA that transcribes into protein structures; "exons ...
Full article >>>

Exon Biotech Pvt Ltd (EBPL) sets out to be the preferred quality partner in the ... Although committed to aquaculture development and sustainability we strive for ...
Full article >>>

John James "Jim" Exon (August 9, 1921 – June 10, 2005) was an American ... Exon was born in Geddes, South Dakota, in 1921 and attended the University of ...
Full article >>>

About Exon-Intron. Exon-Intron, Inc. is a biotechnology education firm. ... Exon-Intron, Inc. P.O. Box 395. Loganville, PA 17342. Tel: 717-428-3780. Tel: 800-407-6546 ...
Full article >>>

Sun 4 binary: exon. Please report broken links. Alphabetic List of Delila Programs ... Documentation for the exon program is below, with links to related programs in ...
Full article >>>

Encyclopedia article about Exon. Information about Exon in the Columbia Encyclopedia, Computer Desktop Encyclopedia, computing dictionary.
Full article >>>

... the two motifs are conserved in mouse orthologous genes that undergo exon skipping. ... For example, mutations in exon 18 of the breast cancer BRCA1 gene cause ...
Full article >>>

PTB: A REPRESSOR OF EXON DEFINITION. MECHANISMS OF PTB REPRESSION ... The recognition of intron-exon boundaries, the splice sites, however, requires ...
Full article >>>


(Date:4/19/2017)... ALBANY, New York , April 19, 2017 /PRNewswire/ ... highly competitive, as its vendor landscape is marked by ... in the market is however held by five major ... and Safran. Together these companies accounted for nearly 61% ... majority of the leading companies in the global military ...
(Date:4/17/2017)... 2017 NXT-ID, Inc. (NASDAQ: NXTD ) ... of its 2016 Annual Report on Form 10-K on Thursday April ... ... in the Investor Relations section of the Company,s website at ... at . 2016 Year Highlights: ...
(Date:4/13/2017)... 2017 According to a new market research report ... Identity Administration, and Authorization), Service, Authentication Type, Deployment Mode, Vertical, and Region ... expected to grow from USD 14.30 Billion in 2017 to USD 31.75 ... ... MarketsandMarkets Logo ...
Breaking Biology News(10 mins):
Other biology dictionary